EMAIL THIS PAGE TO A FRIEND

SAGE1

sarcoma antigen 1

Synonyms: CT14 SAGE
UniProtKB ID: Q9NXZ1, Q5JNW0
Gene ID:
Human(55511) Summary: This gene belongs to a class of genes that are activated in tumors. These genes are expressed in tumors of different histologic types but not in normal tissues, except for spermatogenic cells and, for some, placenta. The proteins encoded by these genes appear to be strictly tumor specific, and hence may be excellent sources of antigens for cancer immunotherapy. This gene is expressed in sarcomas. [provided by RefSeq, Jul 2008]
cow(616666) sarcoma antigen 1
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018666 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136391 MISSION® esiRNA esiRNA human SAGE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018666 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170919 predicted 810
2 SASI_Hs02_00352174 predicted 1803
3 SASI_Hs01_00170923 predicted 590
4 SASI_Hs01_00170924 predicted 2148
5 SASI_Hs01_00170926 predicted 1824
6 SASI_Hs02_00352175 predicted 1696
7 SASI_Hs01_00170927 predicted 436
8 SASI_Hs02_00352176 predicted 1393
9 SASI_Hs01_00170928 predicted 1153
10 SASI_Hs02_00352177 predicted 1568
11 SASI_Hs01_00170920 predicted 673
12 SASI_Hs01_00170921 predicted 1966
13 SASI_Hs01_00170922 predicted 1820
14 SASI_Hs01_00170925 predicted 2395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018666
SAGE1 MISSION shRNA Bacterial Glycerol Stock
sarcoma antigen 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018666.1-2900s1c1
Sequence:CCGGCCAAGGAGAAACAAGGACATACTCGAGTATGTCCTTGTTTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-225s1c1
Sequence:CCGGGCTGCCTATGTGTTTACAAATCTCGAGATTTGTAAACACATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-2139s1c1
Sequence:CCGGGCTGGAATTTCATCCACGATTCTCGAGAATCGTGGATGAAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-1660s1c1
Sequence:CCGGCCCAGACTGATAAGGTCATATCTCGAGATATGACCTTATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-223s1c1
Sequence:CCGGCTGCTGCCTATGTGTTTACAACTCGAGTTGTAAACACATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018666.2-1543s21c1
Sequence:CCGGATGTTCTATCCGGGCTTATTACTCGAGTAATAAGCCCGGATAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018666.2-698s21c1
Sequence:CCGGTGGTCCCACAGGGCTTATTAACTCGAGTTAATAAGCCCTGTGGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018666
SAGE1 MISSION shRNA shRNA Plasmid DNA
sarcoma antigen 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018666.1-2900s1c1
Sequence:CCGGCCAAGGAGAAACAAGGACATACTCGAGTATGTCCTTGTTTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-225s1c1
Sequence:CCGGGCTGCCTATGTGTTTACAAATCTCGAGATTTGTAAACACATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-2139s1c1
Sequence:CCGGGCTGGAATTTCATCCACGATTCTCGAGAATCGTGGATGAAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-1660s1c1
Sequence:CCGGCCCAGACTGATAAGGTCATATCTCGAGATATGACCTTATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-223s1c1
Sequence:CCGGCTGCTGCCTATGTGTTTACAACTCGAGTTGTAAACACATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018666.2-1543s21c1
Sequence:CCGGATGTTCTATCCGGGCTTATTACTCGAGTAATAAGCCCGGATAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018666.2-698s21c1
Sequence:CCGGTGGTCCCACAGGGCTTATTAACTCGAGTTAATAAGCCCTGTGGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018666
SAGE1 MISSION shRNA Lentiviral Transduction Particles
sarcoma antigen 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018666.1-2900s1c1
Sequence:CCGGCCAAGGAGAAACAAGGACATACTCGAGTATGTCCTTGTTTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-225s1c1
Sequence:CCGGGCTGCCTATGTGTTTACAAATCTCGAGATTTGTAAACACATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-2139s1c1
Sequence:CCGGGCTGGAATTTCATCCACGATTCTCGAGAATCGTGGATGAAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-1660s1c1
Sequence:CCGGCCCAGACTGATAAGGTCATATCTCGAGATATGACCTTATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018666.1-223s1c1
Sequence:CCGGCTGCTGCCTATGTGTTTACAACTCGAGTTGTAAACACATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018666.2-1543s21c1
Sequence:CCGGATGTTCTATCCGGGCTTATTACTCGAGTAATAAGCCCGGATAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018666.2-698s21c1
Sequence:CCGGTGGTCCCACAGGGCTTATTAACTCGAGTTAATAAGCCCTGTGGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks