EMAIL THIS PAGE TO A FRIEND

SAMD4A

sterile alpha motif domain containing 4A

Synonyms: SAMD4 SMAUG SMAUG1 SMG SMGA
UniProtKB ID: Q9UPU9, A8MPZ5, Q0VA96, Q6PEW4
Gene ID:
Human(23034) Summary: Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element, which was named after the Drosophila Smaug protein (Baez and Boccaccio, 2005 [PubMed 16221671]
Rat(305826) sterile alpha motif domain containing 4A
cow(540852) sterile alpha motif domain containing 4A
sheep(101117422) sterile alpha motif domain containing 4A
domestic guinea pig(100734357) sterile alpha motif domain containing 4A
naked mole-rat(101707256) sterile alpha motif domain containing 4A
chicken(423559) sterile alpha motif domain containing 4A
domestic cat(101080296) sterile alpha motif domain containing 4A
dog(490700) sterile alpha motif domain containing 4A
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015589 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149321 MISSION® esiRNA esiRNA human SAMD4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015589 Rosetta Predictions human pricing
NM_001107254 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104497 predicted 547
2 SASI_Hs01_00104498 predicted 414
3 SASI_Hs01_00104499 predicted 272
4 SASI_Hs01_00104500 predicted 1673
5 SASI_Hs01_00104501 predicted 762
6 SASI_Hs01_00104502 predicted 1551
7 SASI_Hs01_00104503 predicted 576
8 SASI_Hs01_00104504 predicted 1559
9 SASI_Hs01_00104505 predicted 911
10 SASI_Hs01_00104506 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227025 predicted 658
2 SASI_Rn02_00227026 predicted 839
3 SASI_Rn02_00227027 predicted 1384
4 SASI_Rn02_00227028 predicted 1720
5 SASI_Rn02_00227029 predicted 1015
6 SASI_Rn02_00227030 predicted 1634
7 SASI_Rn02_00227031 predicted 816
8 SASI_Rn02_00227032 predicted 2081
9 SASI_Rn02_00227033 predicted 1019
10 SASI_Rn02_00227034 predicted 1227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015589
VALIDATED
SAMD4A MISSION shRNA Bacterial Glycerol Stock
sterile alpha motif domain containing 4A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015589.3-674s1c1
Sequence:CCGGCCCACCACAATCAATACGATTCTCGAGAATCGTATTGATTGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015589.3-1567s1c1
Sequence:CCGGGCTCATAGACAAGTGTCTAATCTCGAGATTAGACACTTGTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015589.3-211s1c1
Sequence:CCGGGCAACAGGAATCCAAGGATAACTCGAGTTATCCTTGGATTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-998s21c1
Sequence:CCGGAGCCTCCGCCTGCACAAATATCTCGAGATATTTGTGCAGGCGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-282s21c1
Sequence:CCGGTCGACGCGAAAGTAGAATATACTCGAGTATATTCTACTTTCGCGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015589.3-211s21c1
Sequence:CCGGGCAACAGGAATCCAAGGATAACTCGAGTTATCCTTGGATTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-391s21c1
Sequence:CCGGACATCCAGCCACTTCGTTAAACTCGAGTTTAACGAAGTGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015589
VALIDATED
SAMD4A MISSION shRNA shRNA Plasmid DNA
sterile alpha motif domain containing 4A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015589.3-674s1c1
Sequence:CCGGCCCACCACAATCAATACGATTCTCGAGAATCGTATTGATTGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015589.3-1567s1c1
Sequence:CCGGGCTCATAGACAAGTGTCTAATCTCGAGATTAGACACTTGTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015589.3-211s1c1
Sequence:CCGGGCAACAGGAATCCAAGGATAACTCGAGTTATCCTTGGATTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-998s21c1
Sequence:CCGGAGCCTCCGCCTGCACAAATATCTCGAGATATTTGTGCAGGCGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-282s21c1
Sequence:CCGGTCGACGCGAAAGTAGAATATACTCGAGTATATTCTACTTTCGCGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015589.3-211s21c1
Sequence:CCGGGCAACAGGAATCCAAGGATAACTCGAGTTATCCTTGGATTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-391s21c1
Sequence:CCGGACATCCAGCCACTTCGTTAAACTCGAGTTTAACGAAGTGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015589
VALIDATED
SAMD4A MISSION shRNA Lentiviral Transduction Particles
sterile alpha motif domain containing 4A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015589.3-674s1c1
Sequence:CCGGCCCACCACAATCAATACGATTCTCGAGAATCGTATTGATTGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015589.3-1567s1c1
Sequence:CCGGGCTCATAGACAAGTGTCTAATCTCGAGATTAGACACTTGTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015589.3-211s1c1
Sequence:CCGGGCAACAGGAATCCAAGGATAACTCGAGTTATCCTTGGATTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-998s21c1
Sequence:CCGGAGCCTCCGCCTGCACAAATATCTCGAGATATTTGTGCAGGCGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-282s21c1
Sequence:CCGGTCGACGCGAAAGTAGAATATACTCGAGTATATTCTACTTTCGCGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015589.3-211s21c1
Sequence:CCGGGCAACAGGAATCCAAGGATAACTCGAGTTATCCTTGGATTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015589.3-391s21c1
Sequence:CCGGACATCCAGCCACTTCGTTAAACTCGAGTTTAACGAAGTGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks