EMAIL THIS PAGE TO A FRIEND

SAMD8

sterile alpha motif domain containing 8

Synonyms: SMSr
UniProtKB ID: Q96LT4, Q5JSC5, Q5JSC8, Q66K52
Gene ID:
Mouse(67630) sterile alpha motif domain containing 8
Rat(305684) sterile alpha motif domain containing 8
cow(540644) sterile alpha motif domain containing 8
sheep(101103290) sterile alpha motif domain containing 8
domestic guinea pig(100727511) sterile alpha motif domain containing 8
naked mole-rat(101722865) sterile alpha motif domain containing 8
chicken(428946) sterile alpha motif domain containing 8
Horse(100072934) sterile alpha motif domain containing 8
domestic cat(101092547) sterile alpha motif domain containing 8
dog(489056) sterile alpha motif domain containing 8
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144660 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144660 Rosetta Predictions human pricing
NM_001012040 Rosetta Predictions rat pricing
XM_573690 Rosetta Predictions rat pricing
NM_026283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239096 predicted 1151
2 SASI_Hs01_00239097 predicted 653
3 SASI_Hs01_00239098 predicted 202
4 SASI_Hs01_00239099 predicted 661
5 SASI_Hs01_00239100 predicted 520
6 SASI_Hs01_00239101 predicted 577
7 SASI_Hs01_00239102 predicted 216
8 SASI_Hs01_00239103 predicted 1041
9 SASI_Hs01_00239104 predicted 561
10 SASI_Hs01_00239105 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039709 predicted 1182
2 SASI_Rn01_00039710 predicted 215
3 SASI_Rn01_00039711 predicted 852
4 SASI_Rn01_00039712 predicted 1251
5 SASI_Rn01_00039713 predicted 1237
6 SASI_Rn02_00200139 predicted 705
7 SASI_Rn01_00039714 predicted 721
8 SASI_Rn01_00039715 predicted 470
9 SASI_Rn01_00039716 predicted 785
10 SASI_Rn01_00039717 predicted 1205
11 SASI_Rn01_00039718 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185436 predicted 1248
2 SASI_Rn01_00185437 predicted 1293
3 SASI_Rn01_00185438 predicted 1274
4 SASI_Rn01_00185439 predicted 1289
5 SASI_Rn01_00185440 predicted 1284
6 SASI_Rn01_00185441 predicted 1248
7 SASI_Rn01_00185442 predicted 1259
8 SASI_Rn01_00185443 predicted 1293
9 SASI_Rn01_00185444 predicted 1302
10 SASI_Rn01_00185445 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329985 predicted 961
2 SASI_Mm02_00329986 predicted 702
3 SASI_Mm02_00329987 predicted 342
4 SASI_Mm02_00329988 predicted 1280
5 SASI_Mm02_00329989 predicted 636
6 SASI_Mm02_00329990 predicted 759
7 SASI_Mm02_00329991 predicted 1223
8 SASI_Mm02_00329992 predicted 1596
9 SASI_Mm02_00329993 predicted 616
10 SASI_Mm02_00329994 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144660
VALIDATED
SAMD8 MISSION shRNA Bacterial Glycerol Stock
sterile alpha motif domain containing 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-954s1c1
Sequence:CCGGCGTTCACACATGTGGAGATTACTCGAGTAATCTCCACATGTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-898s1c1
Sequence:CCGGGAGAAATTACATCGAGCCTTTCTCGAGAAAGGCTCGATGTAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-253s1c1
Sequence:CCGGCCTCTGGAAATCAAAGTCTTACTCGAGTAAGACTTTGATTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_144660.1-1251s1c1
Sequence:CCGGCCTCTTTGGAATCTTCTTCATCTCGAGATGAAGAAGATTCCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144660.1-707s1c1
Sequence:CCGGGTGGCATGATTCTGTGCTATACTCGAGTATAGCACAGAATCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_144660.1-1214s1c1
Sequence:CCGGGCTGGAATTTCTTGCACACTTCTCGAGAAGTGTGCAAGAAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144660.1-785s1c1
Sequence:CCGGGTAGTCTGATGGGAACTGTATCTCGAGATACAGTTCCCATCAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144660.1-1141s1c1
Sequence:CCGGCGTGACTGAGAAGCATTGGAACTCGAGTTCCAATGCTTCTCAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-687s21c1
Sequence:CCGGCTTTGCCATGACGGAAGTATGCTCGAGCATACTTCCGTCATGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144660.1-1274s21c1
Sequence:CCGGTGGCTGCCCATGAACATTATTCTCGAGAATAATGTTCATGGGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-1043s21c1
Sequence:CCGGTTAGTGCTTCTATGCGTATTACTCGAGTAATACGCATAGAAGCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-635s21c1
Sequence:CCGGATCCACCACTCCCAGATATATCTCGAGATATATCTGGGAGTGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-584s21c1
Sequence:CCGGCATCTTTCATTATGGTTATAGCTCGAGCTATAACCATAATGAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144660
VALIDATED
SAMD8 MISSION shRNA shRNA Plasmid DNA
sterile alpha motif domain containing 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-954s1c1
Sequence:CCGGCGTTCACACATGTGGAGATTACTCGAGTAATCTCCACATGTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-898s1c1
Sequence:CCGGGAGAAATTACATCGAGCCTTTCTCGAGAAAGGCTCGATGTAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-253s1c1
Sequence:CCGGCCTCTGGAAATCAAAGTCTTACTCGAGTAAGACTTTGATTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_144660.1-1251s1c1
Sequence:CCGGCCTCTTTGGAATCTTCTTCATCTCGAGATGAAGAAGATTCCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144660.1-707s1c1
Sequence:CCGGGTGGCATGATTCTGTGCTATACTCGAGTATAGCACAGAATCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_144660.1-1214s1c1
Sequence:CCGGGCTGGAATTTCTTGCACACTTCTCGAGAAGTGTGCAAGAAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144660.1-785s1c1
Sequence:CCGGGTAGTCTGATGGGAACTGTATCTCGAGATACAGTTCCCATCAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144660.1-1141s1c1
Sequence:CCGGCGTGACTGAGAAGCATTGGAACTCGAGTTCCAATGCTTCTCAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-687s21c1
Sequence:CCGGCTTTGCCATGACGGAAGTATGCTCGAGCATACTTCCGTCATGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144660.1-1274s21c1
Sequence:CCGGTGGCTGCCCATGAACATTATTCTCGAGAATAATGTTCATGGGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-1043s21c1
Sequence:CCGGTTAGTGCTTCTATGCGTATTACTCGAGTAATACGCATAGAAGCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-635s21c1
Sequence:CCGGATCCACCACTCCCAGATATATCTCGAGATATATCTGGGAGTGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-584s21c1
Sequence:CCGGCATCTTTCATTATGGTTATAGCTCGAGCTATAACCATAATGAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144660
VALIDATED
SAMD8 MISSION shRNA Lentiviral Transduction Particles
sterile alpha motif domain containing 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-954s1c1
Sequence:CCGGCGTTCACACATGTGGAGATTACTCGAGTAATCTCCACATGTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-898s1c1
Sequence:CCGGGAGAAATTACATCGAGCCTTTCTCGAGAAAGGCTCGATGTAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144660.1-253s1c1
Sequence:CCGGCCTCTGGAAATCAAAGTCTTACTCGAGTAAGACTTTGATTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_144660.1-1251s1c1
Sequence:CCGGCCTCTTTGGAATCTTCTTCATCTCGAGATGAAGAAGATTCCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144660.1-707s1c1
Sequence:CCGGGTGGCATGATTCTGTGCTATACTCGAGTATAGCACAGAATCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_144660.1-1214s1c1
Sequence:CCGGGCTGGAATTTCTTGCACACTTCTCGAGAAGTGTGCAAGAAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144660.1-785s1c1
Sequence:CCGGGTAGTCTGATGGGAACTGTATCTCGAGATACAGTTCCCATCAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144660.1-1141s1c1
Sequence:CCGGCGTGACTGAGAAGCATTGGAACTCGAGTTCCAATGCTTCTCAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-687s21c1
Sequence:CCGGCTTTGCCATGACGGAAGTATGCTCGAGCATACTTCCGTCATGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144660.1-1274s21c1
Sequence:CCGGTGGCTGCCCATGAACATTATTCTCGAGAATAATGTTCATGGGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-1043s21c1
Sequence:CCGGTTAGTGCTTCTATGCGTATTACTCGAGTAATACGCATAGAAGCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-635s21c1
Sequence:CCGGATCCACCACTCCCAGATATATCTCGAGATATATCTGGGAGTGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144660.1-584s21c1
Sequence:CCGGCATCTTTCATTATGGTTATAGCTCGAGCTATAACCATAATGAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026283
VALIDATED
SAMD8 MISSION shRNA Bacterial Glycerol Stock
sterile alpha motif domain containing 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026283.1-1166s1c1
Sequence:CCGGCCACACAGTTGTTCTAACCATCTCGAGATGGTTAGAACAACTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026283.1-1400s1c1
Sequence:CCGGGAGGATTTGGTTCCCTATGTTCTCGAGAACATAGGGAACCAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-1439s21c1
Sequence:CCGGGTTAATGGCACAGTACCTAATCTCGAGATTAGGTACTGTGCCATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-964s21c1
Sequence:CCGGTAGTCTGATGGGCACTGTATTCTCGAGAATACAGTGCCCATCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-1386s21c1
Sequence:CCGGAGAGTAGGAGAGCGAGGATTTCTCGAGAAATCCTCGCTCTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026283.2-1947s1c1
Sequence:CCGGGTGAGTGTCTTACTGGTAAATCTCGAGATTTACCAGTAAGACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-3184s21c1
Sequence:CCGGCTTAGGGCCAAGGGATATATTCTCGAGAATATATCCCTTGGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-761s21c1
Sequence:CCGGACGTCTTTCATTATGGTTATTCTCGAGAATAACCATAATGAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026283
VALIDATED
SAMD8 MISSION shRNA shRNA Plasmid DNA
sterile alpha motif domain containing 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026283.1-1166s1c1
Sequence:CCGGCCACACAGTTGTTCTAACCATCTCGAGATGGTTAGAACAACTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026283.1-1400s1c1
Sequence:CCGGGAGGATTTGGTTCCCTATGTTCTCGAGAACATAGGGAACCAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-1439s21c1
Sequence:CCGGGTTAATGGCACAGTACCTAATCTCGAGATTAGGTACTGTGCCATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-964s21c1
Sequence:CCGGTAGTCTGATGGGCACTGTATTCTCGAGAATACAGTGCCCATCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-1386s21c1
Sequence:CCGGAGAGTAGGAGAGCGAGGATTTCTCGAGAAATCCTCGCTCTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026283.2-1947s1c1
Sequence:CCGGGTGAGTGTCTTACTGGTAAATCTCGAGATTTACCAGTAAGACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-3184s21c1
Sequence:CCGGCTTAGGGCCAAGGGATATATTCTCGAGAATATATCCCTTGGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-761s21c1
Sequence:CCGGACGTCTTTCATTATGGTTATTCTCGAGAATAACCATAATGAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026283
VALIDATED
SAMD8 MISSION shRNA Lentiviral Transduction Particles
sterile alpha motif domain containing 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026283.1-1166s1c1
Sequence:CCGGCCACACAGTTGTTCTAACCATCTCGAGATGGTTAGAACAACTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026283.1-1400s1c1
Sequence:CCGGGAGGATTTGGTTCCCTATGTTCTCGAGAACATAGGGAACCAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-1439s21c1
Sequence:CCGGGTTAATGGCACAGTACCTAATCTCGAGATTAGGTACTGTGCCATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-964s21c1
Sequence:CCGGTAGTCTGATGGGCACTGTATTCTCGAGAATACAGTGCCCATCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-1386s21c1
Sequence:CCGGAGAGTAGGAGAGCGAGGATTTCTCGAGAAATCCTCGCTCTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026283.2-1947s1c1
Sequence:CCGGGTGAGTGTCTTACTGGTAAATCTCGAGATTTACCAGTAAGACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-3184s21c1
Sequence:CCGGCTTAGGGCCAAGGGATATATTCTCGAGAATATATCCCTTGGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026283.2-761s21c1
Sequence:CCGGACGTCTTTCATTATGGTTATTCTCGAGAATAACCATAATGAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks