EMAIL THIS PAGE TO A FRIEND

SAP30L

SAP30-like

Synonyms: NS4ATP2
UniProtKB ID: Q9HAJ7, E9PAU7, E9PAY2
Gene ID:
Mouse(50724) SAP30-like
Rat(360531) SAP30-like
Zebrafish(327079) sap30-like
chicken(416259) SAP30-like
dog(612111) SAP30-like
cow(533462) SAP30-like
sheep(101112317) SAP30-like
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024632 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU196451 MISSION® esiRNA esiRNA targeting mouse Sap30l mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024632 Rosetta Predictions human pricing
XM_001075034 Rosetta Predictions rat pricing
XM_340803 Rosetta Predictions rat pricing
NM_001081168 Rosetta Predictions mouse pricing
XM_203577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223145 predicted 1160
2 SASI_Hs01_00223146 predicted 988
3 SASI_Hs01_00223147 predicted 960
4 SASI_Hs01_00223148 predicted 966
5 SASI_Hs01_00223149 predicted 871
6 SASI_Hs01_00223150 predicted 925
7 SASI_Hs02_00357013 predicted 1140
8 SASI_Hs01_00223151 predicted 1160
9 SASI_Hs01_00223153 predicted 854
10 SASI_Hs01_00223154 predicted 937
11 SASI_Hs01_00223152 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348181 predicted 731
2 SASI_Rn02_00348182 predicted 589
3 SASI_Rn02_00348183 predicted 680
4 SASI_Rn02_00348184 predicted 773
5 SASI_Rn02_00348185 predicted 729
6 SASI_Rn02_00348186 predicted 628
7 SASI_Rn02_00348187 predicted 635
8 SASI_Rn02_00348188 predicted 847
9 SASI_Rn02_00348189 predicted 790
10 SASI_Rn02_00348190 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391919 predicted 1164
2 SASI_Rn02_00391920 predicted 1324
3 SASI_Rn02_00391921 predicted 1118
4 SASI_Rn02_00391922 predicted 1340
5 SASI_Rn02_00391923 predicted 787
6 SASI_Rn02_00391924 predicted 1232
7 SASI_Rn02_00391925 predicted 877
8 SASI_Rn02_00391926 predicted 695
9 SASI_Rn02_00391927 predicted 933
10 SASI_Rn02_00391928 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295851 predicted 892
2 SASI_Mm02_00295852 predicted 870
3 SASI_Mm02_00295853 predicted 719
4 SASI_Mm02_00295854 predicted 904
5 SASI_Mm02_00295855 predicted 857
6 SASI_Mm02_00295856 predicted 927
7 SASI_Mm02_00295857 predicted 760
8 SASI_Mm02_00295858 predicted 985
9 SASI_Mm02_00295859 predicted 829
10 SASI_Mm02_00295860 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282113 predicted 892
2 SASI_Mm01_00282114 predicted 866
3 SASI_Mm01_00282115 predicted 726
4 SASI_Mm01_00282116 predicted 909
5 SASI_Mm01_00282117 predicted 858
6 SASI_Mm01_00282118 predicted 924
7 SASI_Mm01_00282119 predicted 763
8 SASI_Mm01_00282120 predicted 990
9 SASI_Mm01_00282121 predicted 836
10 SASI_Mm01_00282122 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024632
VALIDATED
SAP30L MISSION shRNA Bacterial Glycerol Stock
SAP30-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-996s21c1
Sequence:CCGGGAACACCCTACGACGTTATAACTCGAGTTATAACGTCGTAGGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-846s21c1
Sequence:CCGGGAGCGTAAGGCACCTATATATCTCGAGATATATAGGTGCCTTACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-888s21c1
Sequence:CCGGCATCCAGAGTGTCCGAAATAACTCGAGTTATTTCGGACACTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-1203s1c1
Sequence:CCGGGCCCATAAAGACTGTTAAATACTCGAGTATTTAACAGTCTTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-754s1c1
Sequence:CCGGGAAGAAACTCAAGCTGGACATCTCGAGATGTCCAGCTTGAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024632.3-890s1c1
Sequence:CCGGGACACTGACATTCCTGAGGTTCTCGAGAACCTCAGGAATGTCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024632.3-979s1c1
Sequence:CCGGAGGCTTCAATAAGGCCCAGTTCTCGAGAACTGGGCCTTATTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-790s1c1
Sequence:CCGGGCACCTATATATCTGTGATTTCTCGAGAAATCACAGATATATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024632
VALIDATED
SAP30L MISSION shRNA shRNA Plasmid DNA
SAP30-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-996s21c1
Sequence:CCGGGAACACCCTACGACGTTATAACTCGAGTTATAACGTCGTAGGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-846s21c1
Sequence:CCGGGAGCGTAAGGCACCTATATATCTCGAGATATATAGGTGCCTTACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-888s21c1
Sequence:CCGGCATCCAGAGTGTCCGAAATAACTCGAGTTATTTCGGACACTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-1203s1c1
Sequence:CCGGGCCCATAAAGACTGTTAAATACTCGAGTATTTAACAGTCTTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-754s1c1
Sequence:CCGGGAAGAAACTCAAGCTGGACATCTCGAGATGTCCAGCTTGAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024632.3-890s1c1
Sequence:CCGGGACACTGACATTCCTGAGGTTCTCGAGAACCTCAGGAATGTCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024632.3-979s1c1
Sequence:CCGGAGGCTTCAATAAGGCCCAGTTCTCGAGAACTGGGCCTTATTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-790s1c1
Sequence:CCGGGCACCTATATATCTGTGATTTCTCGAGAAATCACAGATATATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024632
VALIDATED
SAP30L MISSION shRNA Lentiviral Transduction Particles
SAP30-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-996s21c1
Sequence:CCGGGAACACCCTACGACGTTATAACTCGAGTTATAACGTCGTAGGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-846s21c1
Sequence:CCGGGAGCGTAAGGCACCTATATATCTCGAGATATATAGGTGCCTTACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024632.5-888s21c1
Sequence:CCGGCATCCAGAGTGTCCGAAATAACTCGAGTTATTTCGGACACTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-1203s1c1
Sequence:CCGGGCCCATAAAGACTGTTAAATACTCGAGTATTTAACAGTCTTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-754s1c1
Sequence:CCGGGAAGAAACTCAAGCTGGACATCTCGAGATGTCCAGCTTGAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024632.3-890s1c1
Sequence:CCGGGACACTGACATTCCTGAGGTTCTCGAGAACCTCAGGAATGTCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024632.3-979s1c1
Sequence:CCGGAGGCTTCAATAAGGCCCAGTTCTCGAGAACTGGGCCTTATTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024632.3-790s1c1
Sequence:CCGGGCACCTATATATCTGTGATTTCTCGAGAAATCACAGATATATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081168
VALIDATED
SAP30L MISSION shRNA Bacterial Glycerol Stock
SAP30-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000225828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-650s21c1
Sequence:CCGGGAGCGTAAGGCACCTGTATATCTCGAGATATACAGGTGCCTTACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-811s21c1
Sequence:CCGGGACGTTACAAACGGCACTATACTCGAGTATAGTGCCGTTTGTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-1094s21c1
Sequence:GTACCGGGCCAATAAGGACTGTTCATATCTCGAGATATGAACAGTCCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-883s21c1
Sequence:CCGGGCCGACACTTCAGGAACATACCTCGAGGTATGTTCCTGAAGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081168
VALIDATED
SAP30L MISSION shRNA shRNA Plasmid DNA
SAP30-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000225828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-650s21c1
Sequence:CCGGGAGCGTAAGGCACCTGTATATCTCGAGATATACAGGTGCCTTACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-811s21c1
Sequence:CCGGGACGTTACAAACGGCACTATACTCGAGTATAGTGCCGTTTGTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-1094s21c1
Sequence:GTACCGGGCCAATAAGGACTGTTCATATCTCGAGATATGAACAGTCCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-883s21c1
Sequence:CCGGGCCGACACTTCAGGAACATACCTCGAGGTATGTTCCTGAAGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081168
VALIDATED
SAP30L MISSION shRNA Lentiviral Transduction Particles
SAP30-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000225828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-650s21c1
Sequence:CCGGGAGCGTAAGGCACCTGTATATCTCGAGATATACAGGTGCCTTACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-811s21c1
Sequence:CCGGGACGTTACAAACGGCACTATACTCGAGTATAGTGCCGTTTGTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-1094s21c1
Sequence:GTACCGGGCCAATAAGGACTGTTCATATCTCGAGATATGAACAGTCCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081168.1-883s21c1
Sequence:CCGGGCCGACACTTCAGGAACATACCTCGAGGTATGTTCCTGAAGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks