EMAIL THIS PAGE TO A FRIEND

SARS

seryl-tRNA synthetase

Synonyms: SERRS SERS
UniProtKB ID: P49591, B2R6Y9, Q5T5C8, Q9NSE3
Gene ID:
Human(6301) Summary: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. [provided by RefSeq, Jul 2010]
Mouse(20226) seryl-aminoacyl-tRNA synthetase
Rat(266975) seryl-tRNA synthetase
naked mole-rat(101726419) seryl-tRNA synthetase
Domestic Rabbit(100339002) seryl-tRNA synthetase
domestic guinea pig(100729314) seryl-tRNA synthetase
cow(281476) seryl-tRNA synthetase
sheep(100135438) seryl-tRNA synthetase
Zebrafish(445405) seryl-tRNA synthetase
chicken(426697) seryl-tRNA synthetase
domestic cat(101089705) seryl-tRNA synthetase
dog(490124) seryl-tRNA synthetase
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006513 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006513 Rosetta Predictions human pricing
NM_001007606 Rosetta Predictions rat pricing
NM_011319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144589 predicted 1555
2 SASI_Hs01_00144590 predicted 797
3 SASI_Hs01_00144591 predicted 336
4 SASI_Hs01_00144593 predicted 1155
5 SASI_Hs01_00144594 predicted 1257
6 SASI_Hs01_00144595 predicted 237
7 SASI_Hs01_00144596 predicted 798
8 SASI_Hs01_00144597 predicted 218
9 SASI_Hs02_00341734 predicted 1420
10 SASI_Hs01_00144598 predicted 327
11 SASI_Hs01_00144592 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063550 predicted 434
2 SASI_Rn01_00063551 predicted 1447
3 SASI_Rn01_00063552 predicted 1312
4 SASI_Rn01_00063553 predicted 453
5 SASI_Rn02_00198691 predicted 783
6 SASI_Rn01_00063555 predicted 508
7 SASI_Rn01_00063556 predicted 1061
8 SASI_Rn01_00063557 predicted 1235
9 SASI_Rn01_00063558 predicted 1603
10 SASI_Rn01_00063559 predicted 864
11 SASI_Rn01_00063554 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152234 predicted 509
2 SASI_Mm01_00152235 predicted 489
3 SASI_Mm01_00152236 predicted 754
4 SASI_Mm01_00152237 predicted 1318
5 SASI_Mm01_00152238 predicted 819
6 SASI_Mm01_00152239 predicted 1214
7 SASI_Mm02_00320407 predicted 393
8 SASI_Mm01_00152240 predicted 419
9 SASI_Mm01_00152241 predicted 801
10 SASI_Mm01_00152242 predicted 325
11 SASI_Mm01_00152243 predicted 1564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006513
VALIDATED
SARS MISSION shRNA Bacterial Glycerol Stock
seryl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-361s1c1
Sequence:CCGGGCTAACCTGAAAGTCTCACAACTCGAGTTGTGAGACTTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006513.2-1256s1c1
Sequence:CCGGCCTGTTCTAATTGCACGGATTCTCGAGAATCCGTGCAATTAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-505s1c1
Sequence:CCGGCCCATCAGTAACGATGAGGATCTCGAGATCCTCATCGTTACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006513.2-1431s1c1
Sequence:CCGGGCCTGAGAAATTGAAGGAGTTCTCGAGAACTCCTTCAATTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-1030s1c1
Sequence:CCGGCATCAGTTTGAGAAGATTGAACTCGAGTTCAATCTTCTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-863s21c1
Sequence:CCGGATGATGAGAAGTACCTGATTGCTCGAGCAATCAGGTACTTCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1147s21c1
Sequence:CCGGCCTTACCACATTGTGAATATTCTCGAGAATATTCACAATGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1635s21c1
Sequence:CCGGCTATTTGCCAGGCTTTCATTTCTCGAGAAATGAAAGCCTGGCAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1030s21c1
Sequence:CCGGCATCAGTTTGAGAAGATTGAACTCGAGTTCAATCTTCTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-361s21c1
Sequence:CCGGGCTAACCTGAAAGTCTCACAACTCGAGTTGTGAGACTTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006513
VALIDATED
SARS MISSION shRNA shRNA Plasmid DNA
seryl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-361s1c1
Sequence:CCGGGCTAACCTGAAAGTCTCACAACTCGAGTTGTGAGACTTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006513.2-1256s1c1
Sequence:CCGGCCTGTTCTAATTGCACGGATTCTCGAGAATCCGTGCAATTAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-505s1c1
Sequence:CCGGCCCATCAGTAACGATGAGGATCTCGAGATCCTCATCGTTACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006513.2-1431s1c1
Sequence:CCGGGCCTGAGAAATTGAAGGAGTTCTCGAGAACTCCTTCAATTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-1030s1c1
Sequence:CCGGCATCAGTTTGAGAAGATTGAACTCGAGTTCAATCTTCTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-863s21c1
Sequence:CCGGATGATGAGAAGTACCTGATTGCTCGAGCAATCAGGTACTTCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1147s21c1
Sequence:CCGGCCTTACCACATTGTGAATATTCTCGAGAATATTCACAATGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1635s21c1
Sequence:CCGGCTATTTGCCAGGCTTTCATTTCTCGAGAAATGAAAGCCTGGCAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1030s21c1
Sequence:CCGGCATCAGTTTGAGAAGATTGAACTCGAGTTCAATCTTCTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-361s21c1
Sequence:CCGGGCTAACCTGAAAGTCTCACAACTCGAGTTGTGAGACTTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006513
VALIDATED
SARS MISSION shRNA Lentiviral Transduction Particles
seryl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-361s1c1
Sequence:CCGGGCTAACCTGAAAGTCTCACAACTCGAGTTGTGAGACTTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006513.2-1256s1c1
Sequence:CCGGCCTGTTCTAATTGCACGGATTCTCGAGAATCCGTGCAATTAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-505s1c1
Sequence:CCGGCCCATCAGTAACGATGAGGATCTCGAGATCCTCATCGTTACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006513.2-1431s1c1
Sequence:CCGGGCCTGAGAAATTGAAGGAGTTCTCGAGAACTCCTTCAATTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006513.2-1030s1c1
Sequence:CCGGCATCAGTTTGAGAAGATTGAACTCGAGTTCAATCTTCTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-863s21c1
Sequence:CCGGATGATGAGAAGTACCTGATTGCTCGAGCAATCAGGTACTTCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1147s21c1
Sequence:CCGGCCTTACCACATTGTGAATATTCTCGAGAATATTCACAATGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1635s21c1
Sequence:CCGGCTATTTGCCAGGCTTTCATTTCTCGAGAAATGAAAGCCTGGCAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-1030s21c1
Sequence:CCGGCATCAGTTTGAGAAGATTGAACTCGAGTTCAATCTTCTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006513.2-361s21c1
Sequence:CCGGGCTAACCTGAAAGTCTCACAACTCGAGTTGTGAGACTTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011319
VALIDATED
SARS MISSION shRNA Bacterial Glycerol Stock
seryl-tRNA synthetase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-1656s1c1
Sequence:CCGGCCAGACTTACTTACTAAGCCTCTCGAGAGGCTTAGTAAGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-1379s1c1
Sequence:CCGGCCATATGCTTAATGCTACAATCTCGAGATTGTAGCATTAAGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-492s1c1
Sequence:CCGGGACAACAAAGTAGAACGTATTCTCGAGAATACGTTCTACTTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011319.1-278s1c1
Sequence:CCGGCCCAGAGAACGTGCTGAATTTCTCGAGAAATTCAGCACGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-277s21c1
Sequence:CCGGCCCAGAGAACGTGCTGAATTTCTCGAGAAATTCAGCACGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-1378s21c1
Sequence:CCGGCCATATGCTTAATGCTACAATCTCGAGATTGTAGCATTAAGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-1655s21c1
Sequence:CCGGCCAGACTTACTTACTAAGCCTCTCGAGAGGCTTAGTAAGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-491s21c1
Sequence:CCGGGACAACAAAGTAGAACGTATTCTCGAGAATACGTTCTACTTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011319
VALIDATED
SARS MISSION shRNA shRNA Plasmid DNA
seryl-tRNA synthetase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-1656s1c1
Sequence:CCGGCCAGACTTACTTACTAAGCCTCTCGAGAGGCTTAGTAAGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-1379s1c1
Sequence:CCGGCCATATGCTTAATGCTACAATCTCGAGATTGTAGCATTAAGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-492s1c1
Sequence:CCGGGACAACAAAGTAGAACGTATTCTCGAGAATACGTTCTACTTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011319.1-278s1c1
Sequence:CCGGCCCAGAGAACGTGCTGAATTTCTCGAGAAATTCAGCACGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-277s21c1
Sequence:CCGGCCCAGAGAACGTGCTGAATTTCTCGAGAAATTCAGCACGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-1378s21c1
Sequence:CCGGCCATATGCTTAATGCTACAATCTCGAGATTGTAGCATTAAGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-1655s21c1
Sequence:CCGGCCAGACTTACTTACTAAGCCTCTCGAGAGGCTTAGTAAGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-491s21c1
Sequence:CCGGGACAACAAAGTAGAACGTATTCTCGAGAATACGTTCTACTTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011319
VALIDATED
SARS MISSION shRNA Lentiviral Transduction Particles
seryl-tRNA synthetase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-1656s1c1
Sequence:CCGGCCAGACTTACTTACTAAGCCTCTCGAGAGGCTTAGTAAGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-1379s1c1
Sequence:CCGGCCATATGCTTAATGCTACAATCTCGAGATTGTAGCATTAAGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011319.1-492s1c1
Sequence:CCGGGACAACAAAGTAGAACGTATTCTCGAGAATACGTTCTACTTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011319.1-278s1c1
Sequence:CCGGCCCAGAGAACGTGCTGAATTTCTCGAGAAATTCAGCACGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-277s21c1
Sequence:CCGGCCCAGAGAACGTGCTGAATTTCTCGAGAAATTCAGCACGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-1378s21c1
Sequence:CCGGCCATATGCTTAATGCTACAATCTCGAGATTGTAGCATTAAGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-1655s21c1
Sequence:CCGGCCAGACTTACTTACTAAGCCTCTCGAGAGGCTTAGTAAGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011319.2-491s21c1
Sequence:CCGGGACAACAAAGTAGAACGTATTCTCGAGAATACGTTCTACTTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks