EMAIL THIS PAGE TO A FRIEND

SCAPER

S-phase cyclin A-associated protein in the ER

Synonyms: ZNF291 Zfp291
Gene ID:
Mouse(244891) S phase cyclin A-associated protein in the ER
Rat(117521) S-phase cyclin A-associated protein in the ER
cow(100140107) S-phase cyclin A-associated protein in the ER
sheep(101103511) S-phase cyclin A-associated protein in the ER
cow(534495) S-phase cyclin A-associated protein in the ER
domestic guinea pig(100732071) S-phase cyclin A-associated protein in the ER
Zebrafish(100144551) S phase cyclin A-associated protein in the ER
chicken(415352) S-phase cyclin A-associated protein in the ER
Horse(100061025) S-phase cyclin A-associated protein in the ER
domestic cat(101099719) S-phase cyclin A-associated protein in the ER
dog(478373) S-phase cyclin A-associated protein in the ER
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020843 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020843 Rosetta Predictions human pricing
XM_001070332 Rosetta Predictions rat pricing
XM_343394 Rosetta Predictions rat pricing
NM_001081341 Rosetta Predictions mouse pricing
XM_620753 Rosetta Predictions mouse pricing
XM_895897 Rosetta Predictions mouse pricing
XM_895914 Rosetta Predictions mouse pricing
XM_974830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189308 predicted 849
2 SASI_Hs02_00354090 predicted 1971
3 SASI_Hs01_00189310 predicted 3318
4 SASI_Hs01_00189311 predicted 1883
5 SASI_Hs01_00189312 predicted 431
6 SASI_Hs02_00354091 predicted 415
7 SASI_Hs02_00354092 predicted 3815
8 SASI_Hs02_00354093 predicted 1058
9 SASI_Hs01_00189316 predicted 701
10 SASI_Hs01_00189317 predicted 3989
11 SASI_Hs01_00189309 predicted 1851
12 SASI_Hs01_00189313 predicted 991
13 SASI_Hs01_00189314 predicted 968
14 SASI_Hs01_00189315 predicted 3875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331278 predicted 586
2 SASI_Rn02_00331279 predicted 550
3 SASI_Rn02_00331280 predicted 1619
4 SASI_Rn02_00331281 predicted 343
5 SASI_Rn02_00331282 predicted 314
6 SASI_Rn02_00331283 predicted 1201
7 SASI_Rn02_00331284 predicted 4100
8 SASI_Rn02_00331285 predicted 1638
9 SASI_Rn02_00331286 predicted 2076
10 SASI_Rn02_00331287 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395724 predicted 568
2 SASI_Rn02_00395725 predicted 528
3 SASI_Rn02_00395726 predicted 1604
4 SASI_Rn02_00395727 predicted 333
5 SASI_Rn02_00395728 predicted 301
6 SASI_Rn02_00395729 predicted 1191
7 SASI_Rn02_00395730 predicted 4079
8 SASI_Rn02_00395731 predicted 1623
9 SASI_Rn02_00395732 predicted 2065
10 SASI_Rn02_00395733 predicted 1993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297461 predicted 369
2 SASI_Mm02_00297462 predicted 613
3 SASI_Mm02_00297463 predicted 3015
4 SASI_Mm02_00297464 predicted 249
5 SASI_Mm02_00297465 predicted 1653
6 SASI_Mm02_00297466 predicted 2424
7 SASI_Mm02_00297467 predicted 338
8 SASI_Mm02_00297468 predicted 1224
9 SASI_Mm02_00297469 predicted 1141
10 SASI_Mm02_00297470 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217603 predicted 353
2 SASI_Mm01_00217604 predicted 597
3 SASI_Mm01_00217605 predicted 2978
4 SASI_Mm01_00217606 predicted 226
5 SASI_Mm01_00217607 predicted 1615
6 SASI_Mm01_00217608 predicted 2389
7 SASI_Mm01_00217609 predicted 315
8 SASI_Mm01_00217610 predicted 1123
9 SASI_Mm01_00217611 predicted 1000
10 SASI_Mm01_00217612 predicted 2085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215124 predicted 878
2 SASI_Mm01_00215125 predicted 889
3 SASI_Mm01_00215126 predicted 1655
4 SASI_Mm01_00215127 predicted 1696
5 SASI_Mm01_00215128 predicted 1075
6 SASI_Mm01_00215129 predicted 1924
7 SASI_Mm01_00215130 predicted 1652
8 SASI_Mm01_00215131 predicted 1828
9 SASI_Mm01_00215132 predicted 767
10 SASI_Mm01_00215133 predicted 1816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220463 predicted 372
2 SASI_Mm01_00220464 predicted 612
3 SASI_Mm01_00220465 predicted 3019
4 SASI_Mm01_00220466 predicted 253
5 SASI_Mm01_00220467 predicted 1663
6 SASI_Mm01_00220468 predicted 2435
7 SASI_Mm01_00220469 predicted 336
8 SASI_Mm01_00220470 predicted 1142
9 SASI_Mm01_00220471 predicted 1016
10 SASI_Mm01_00220472 predicted 2125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218219 predicted 369
2 SASI_Mm01_00218220 predicted 613
3 SASI_Mm01_00218221 predicted 3005
4 SASI_Mm01_00218222 predicted 249
5 SASI_Mm01_00218223 predicted 1637
6 SASI_Mm01_00218224 predicted 2411
7 SASI_Mm01_00218225 predicted 340
8 SASI_Mm01_00218226 predicted 1148
9 SASI_Mm01_00218227 predicted 1015
10 SASI_Mm01_00218228 predicted 2111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020843
VALIDATED
SCAPER MISSION shRNA Bacterial Glycerol Stock
S-phase cyclin A-associated protein in the ER
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020843.2-988s21c1
Sequence:CCGGGCATACAGAAAGGTCAATTTGCTCGAGCAAATTGACCTTTCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020843.2-3123s21c1
Sequence:CCGGATACACCAGTTGACGGTTTATCTCGAGATAAACCGTCAACTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020843.2-4387s21c1
Sequence:CCGGGCATGTACTTTACACTATTTACTCGAGTAAATAGTGTAAAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-3451s1c1
Sequence:CCGGCGCAGGACTCTTACATGCAATCTCGAGATTGCATGTAAGAGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-4387s1c1
Sequence:CCGGGACTGTAGATACTTGAATGTTCTCGAGAACATTCAAGTATCTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-525s1c1
Sequence:CCGGGCAGACCAACATCATTGGCATCTCGAGATGCCAATGATGTTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-1934s1c1
Sequence:CCGGGCCCAGAATAAACGTCATGATCTCGAGATCATGACGTTTATTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-371s1c1
Sequence:CCGGGCAGTAGATGAAATCTATGTACTCGAGTACATAGATTTCATCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020843.1-2681s1c1
Sequence:CCGGGCTAAGGAATATGAGAGTTTACTCGAGTAAACTCTCATATTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-4498s1c1
Sequence:CCGGGCATTTGTGATATGGGTGAAACTCGAGTTTCACCCATATCACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020843.1-4328s1c1
Sequence:CCGGCCCATGTTTATACTCTTCCCACTCGAGTGGGAAGAGTATAAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020843
VALIDATED
SCAPER MISSION shRNA shRNA Plasmid DNA
S-phase cyclin A-associated protein in the ER
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020843.2-988s21c1
Sequence:CCGGGCATACAGAAAGGTCAATTTGCTCGAGCAAATTGACCTTTCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020843.2-3123s21c1
Sequence:CCGGATACACCAGTTGACGGTTTATCTCGAGATAAACCGTCAACTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020843.2-4387s21c1
Sequence:CCGGGCATGTACTTTACACTATTTACTCGAGTAAATAGTGTAAAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-3451s1c1
Sequence:CCGGCGCAGGACTCTTACATGCAATCTCGAGATTGCATGTAAGAGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-4387s1c1
Sequence:CCGGGACTGTAGATACTTGAATGTTCTCGAGAACATTCAAGTATCTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-525s1c1
Sequence:CCGGGCAGACCAACATCATTGGCATCTCGAGATGCCAATGATGTTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-1934s1c1
Sequence:CCGGGCCCAGAATAAACGTCATGATCTCGAGATCATGACGTTTATTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-371s1c1
Sequence:CCGGGCAGTAGATGAAATCTATGTACTCGAGTACATAGATTTCATCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020843.1-2681s1c1
Sequence:CCGGGCTAAGGAATATGAGAGTTTACTCGAGTAAACTCTCATATTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-4498s1c1
Sequence:CCGGGCATTTGTGATATGGGTGAAACTCGAGTTTCACCCATATCACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020843.1-4328s1c1
Sequence:CCGGCCCATGTTTATACTCTTCCCACTCGAGTGGGAAGAGTATAAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020843
VALIDATED
SCAPER MISSION shRNA Lentiviral Transduction Particles
S-phase cyclin A-associated protein in the ER
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020843.2-988s21c1
Sequence:CCGGGCATACAGAAAGGTCAATTTGCTCGAGCAAATTGACCTTTCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020843.2-3123s21c1
Sequence:CCGGATACACCAGTTGACGGTTTATCTCGAGATAAACCGTCAACTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020843.2-4387s21c1
Sequence:CCGGGCATGTACTTTACACTATTTACTCGAGTAAATAGTGTAAAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-3451s1c1
Sequence:CCGGCGCAGGACTCTTACATGCAATCTCGAGATTGCATGTAAGAGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-4387s1c1
Sequence:CCGGGACTGTAGATACTTGAATGTTCTCGAGAACATTCAAGTATCTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-525s1c1
Sequence:CCGGGCAGACCAACATCATTGGCATCTCGAGATGCCAATGATGTTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020843.1-1934s1c1
Sequence:CCGGGCCCAGAATAAACGTCATGATCTCGAGATCATGACGTTTATTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-371s1c1
Sequence:CCGGGCAGTAGATGAAATCTATGTACTCGAGTACATAGATTTCATCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020843.1-2681s1c1
Sequence:CCGGGCTAAGGAATATGAGAGTTTACTCGAGTAAACTCTCATATTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020843.1-4498s1c1
Sequence:CCGGGCATTTGTGATATGGGTGAAACTCGAGTTTCACCCATATCACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020843.1-4328s1c1
Sequence:CCGGCCCATGTTTATACTCTTCCCACTCGAGTGGGAAGAGTATAAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081341
VALIDATED
SCAPER MISSION shRNA Bacterial Glycerol Stock
S-phase cyclin A-associated protein in the ER
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081341.1-4764s21c1
Sequence:GTACCGGAGTAAGCCTTTGTACTATTTGCTCGAGCAAATAGTACAAAGGCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081341.1-3238s21c1
Sequence:CCGGATACACCAATTGACGGTTTATCTCGAGATAAACCGTCAATTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081341.1-2859s21c1
Sequence:CCGGTGGCTCCGAGTCACCTTATAACTCGAGTTATAAGGTGACTCGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081341.1-1644s21c1
Sequence:CCGGGAATGATGTTCTCGCAGATTACTCGAGTAATCTGCGAGAACATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081341.1-339s21c1
Sequence:CCGGGACAATTCAAGGCACTCATAACTCGAGTTATGAGTGCCTTGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081341
VALIDATED
SCAPER MISSION shRNA shRNA Plasmid DNA
S-phase cyclin A-associated protein in the ER
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081341.1-4764s21c1
Sequence:GTACCGGAGTAAGCCTTTGTACTATTTGCTCGAGCAAATAGTACAAAGGCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081341.1-3238s21c1
Sequence:CCGGATACACCAATTGACGGTTTATCTCGAGATAAACCGTCAATTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081341.1-2859s21c1
Sequence:CCGGTGGCTCCGAGTCACCTTATAACTCGAGTTATAAGGTGACTCGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081341.1-1644s21c1
Sequence:CCGGGAATGATGTTCTCGCAGATTACTCGAGTAATCTGCGAGAACATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081341.1-339s21c1
Sequence:CCGGGACAATTCAAGGCACTCATAACTCGAGTTATGAGTGCCTTGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081341
VALIDATED
SCAPER MISSION shRNA Lentiviral Transduction Particles
S-phase cyclin A-associated protein in the ER
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081341.1-4764s21c1
Sequence:GTACCGGAGTAAGCCTTTGTACTATTTGCTCGAGCAAATAGTACAAAGGCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081341.1-3238s21c1
Sequence:CCGGATACACCAATTGACGGTTTATCTCGAGATAAACCGTCAATTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081341.1-2859s21c1
Sequence:CCGGTGGCTCCGAGTCACCTTATAACTCGAGTTATAAGGTGACTCGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081341.1-1644s21c1
Sequence:CCGGGAATGATGTTCTCGCAGATTACTCGAGTAATCTGCGAGAACATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081341.1-339s21c1
Sequence:CCGGGACAATTCAAGGCACTCATAACTCGAGTTATGAGTGCCTTGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks