EMAIL THIS PAGE TO A FRIEND

SCARA5

scavenger receptor class A, member 5 (putative)

Synonyms: NET33 Tesr
UniProtKB ID: Q6ZMJ2, Q6UXZ1, Q7Z4A1, Q8N4Z7
Gene ID:
Mouse(71145) scavenger receptor class A, member 5 (putative)
Rat(305974) scavenger receptor class A, member 5 (putative)
cow(516087) scavenger receptor class A, member 5 (putative)
sheep(101114933) scavenger receptor class A, member 5 (putative)
naked mole-rat(101721242) scavenger receptor class A, member 5 (putative)
domestic guinea pig(100712886) scavenger receptor class A, member 5 (putative)
Zebrafish(564500) scavenger receptor class A, member 5 (putative)
chicken(771061) scavenger receptor class A, member 5 (putative)
domestic cat(101093600) scavenger receptor class A, member 5 (putative)
dog(486097) scavenger receptor class A, member 5 (putative)
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1678 Human SCARA5 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173833 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015051 MISSION® esiRNA esiRNA targeting mouse Scara5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173833 Rosetta Predictions human pricing
XM_001066668 Rosetta Predictions rat pricing
XM_224299 Rosetta Predictions rat pricing
NM_028903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108488 predicted 2171
2 SASI_Hs01_00108489 predicted 2296
3 SASI_Hs01_00108490 predicted 1334
4 SASI_Hs02_00368707 predicted 2073
5 SASI_Hs01_00108491 predicted 2346
6 SASI_Hs01_00108492 predicted 2332
7 SASI_Hs01_00108494 predicted 1907
8 SASI_Hs01_00108495 predicted 2337
9 SASI_Hs01_00108496 predicted 2205
10 SASI_Hs01_00108497 predicted 2273
11 SASI_Hs01_00108493 predicted 2233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318361 predicted 1131
2 SASI_Rn02_00318362 predicted 444
3 SASI_Rn02_00318363 predicted 1026
4 SASI_Rn02_00318364 predicted 670
5 SASI_Rn02_00318365 predicted 640
6 SASI_Rn02_00318366 predicted 1136
7 SASI_Rn02_00318367 predicted 450
8 SASI_Rn02_00318368 predicted 1050
9 SASI_Rn02_00318369 predicted 451
10 SASI_Rn02_00318370 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381899 predicted 393
2 SASI_Rn02_00381900 predicted 448
3 SASI_Rn02_00381901 predicted 364
4 SASI_Rn02_00381902 predicted 359
5 SASI_Rn02_00381903 predicted 453
6 SASI_Rn02_00381904 predicted 446
7 SASI_Rn02_00381905 predicted 363
8 SASI_Rn02_00381906 predicted 392
9 SASI_Rn02_00381907 predicted 454
10 SASI_Rn02_00381908 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033701 predicted 2158
2 SASI_Mm01_00033702 predicted 331
3 SASI_Mm01_00033703 predicted 582
4 SASI_Mm01_00033704 predicted 1671
5 SASI_Mm01_00033706 predicted 2088
6 SASI_Mm02_00334584 predicted 2136
7 SASI_Mm01_00033707 predicted 1683
8 SASI_Mm01_00033708 predicted 2058
9 SASI_Mm01_00033709 predicted 370
10 SASI_Mm02_00334585 predicted 1752
11 SASI_Mm01_00033700 predicted 2157
12 SASI_Mm01_00033705 predicted 2153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028903
VALIDATED
SCARA5 MISSION shRNA Bacterial Glycerol Stock
scavenger receptor class A, member 5 (putative)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-612s21c1
Sequence:CCGGCGGAACGTCAACCGGCTGAATCTCGAGATTCAGCCGGTTGACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028903.1-2265s21c1
Sequence:CCGGCCCAGCAAGTAGAAACCCTTACTCGAGTAAGGGTTTCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-1527s21c1
Sequence:CCGGCGGGTGGAGGTGTTCCATGATCTCGAGATCATGGAACACCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-1676s21c1
Sequence:CCGGGATTTGGATGGACGATGTGAACTCGAGTTCACATCGTCCATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-2265s1c1
Sequence:CCGGCCCAGCAAGTAGAAACCCTTACTCGAGTAAGGGTTTCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-1676s1c1
Sequence:CCGGGATTTGGATGGACGATGTGAACTCGAGTTCACATCGTCCATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-612s1c1
Sequence:CCGGCGGAACGTCAACCGGCTGAATCTCGAGATTCAGCCGGTTGACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-378s1c1
Sequence:CCGGTCCATCTTTGAAGAACCCTTTCTCGAGAAAGGGTTCTTCAAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-1527s1c1
Sequence:CCGGCGGGTGGAGGTGTTCCATGATCTCGAGATCATGGAACACCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028903
VALIDATED
SCARA5 MISSION shRNA shRNA Plasmid DNA
scavenger receptor class A, member 5 (putative)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-612s21c1
Sequence:CCGGCGGAACGTCAACCGGCTGAATCTCGAGATTCAGCCGGTTGACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028903.1-2265s21c1
Sequence:CCGGCCCAGCAAGTAGAAACCCTTACTCGAGTAAGGGTTTCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-1527s21c1
Sequence:CCGGCGGGTGGAGGTGTTCCATGATCTCGAGATCATGGAACACCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-1676s21c1
Sequence:CCGGGATTTGGATGGACGATGTGAACTCGAGTTCACATCGTCCATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-2265s1c1
Sequence:CCGGCCCAGCAAGTAGAAACCCTTACTCGAGTAAGGGTTTCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-1676s1c1
Sequence:CCGGGATTTGGATGGACGATGTGAACTCGAGTTCACATCGTCCATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-612s1c1
Sequence:CCGGCGGAACGTCAACCGGCTGAATCTCGAGATTCAGCCGGTTGACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-378s1c1
Sequence:CCGGTCCATCTTTGAAGAACCCTTTCTCGAGAAAGGGTTCTTCAAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-1527s1c1
Sequence:CCGGCGGGTGGAGGTGTTCCATGATCTCGAGATCATGGAACACCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028903
VALIDATED
SCARA5 MISSION shRNA Lentiviral Transduction Particles
scavenger receptor class A, member 5 (putative)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-612s21c1
Sequence:CCGGCGGAACGTCAACCGGCTGAATCTCGAGATTCAGCCGGTTGACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028903.1-2265s21c1
Sequence:CCGGCCCAGCAAGTAGAAACCCTTACTCGAGTAAGGGTTTCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-1527s21c1
Sequence:CCGGCGGGTGGAGGTGTTCCATGATCTCGAGATCATGGAACACCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028903.1-1676s21c1
Sequence:CCGGGATTTGGATGGACGATGTGAACTCGAGTTCACATCGTCCATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-2265s1c1
Sequence:CCGGCCCAGCAAGTAGAAACCCTTACTCGAGTAAGGGTTTCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-1676s1c1
Sequence:CCGGGATTTGGATGGACGATGTGAACTCGAGTTCACATCGTCCATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-612s1c1
Sequence:CCGGCGGAACGTCAACCGGCTGAATCTCGAGATTCAGCCGGTTGACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-378s1c1
Sequence:CCGGTCCATCTTTGAAGAACCCTTTCTCGAGAAAGGGTTCTTCAAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028903.1-1527s1c1
Sequence:CCGGCGGGTGGAGGTGTTCCATGATCTCGAGATCATGGAACACCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173833
SCARA5 MISSION shRNA Bacterial Glycerol Stock
scavenger receptor class A, member 5 (putative)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-436s1c1
Sequence:CCGGCCATCTGTGAGGATTCCTTTGCTCGAGCAAAGGAATCCTCACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173833.2-590s1c1
Sequence:CCGGCTTCCTGATTCTTGTGGGCATCTCGAGATGCCCACAAGAATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1727s1c1
Sequence:CCGGGCCACATTTCTAGAGGTGTCACTCGAGTGACACCTCTAGAAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-489s1c1
Sequence:CCGGGAGGATGGTCCATGTCACAAACTCGAGTTTGTGACATGGACCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-1530s1c1
Sequence:CCGGGATGCCAGTAAGGACATTCTGCTCGAGCAGAATGTCCTTACTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173833.2-1806s1c1
Sequence:CCGGGCTGGTATAATCTCTGTGCCTCTCGAGAGGCACAGAGATTATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-582s1c1
Sequence:CCGGCTGCTGGTCTTCCTGATTCTTCTCGAGAAGAATCAGGAAGACCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-671s1c1
Sequence:CCGGCAATGTGAACCGGCTGAATGACTCGAGTCATTCAGCCGGTTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1690s1c1
Sequence:CCGGGTCTAGCAAGAGATGCTGATACTCGAGTATCAGCATCTCTTGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-607s1c1
Sequence:CCGGGCATCTTCATCTTAGCAGTGTCTCGAGACACTGCTAAGATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1728s1c1
Sequence:CCGGCCACATTTCTAGAGGTGTCATCTCGAGATGACACCTCTAGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173833.2-593s1c1
Sequence:CCGGCCTGATTCTTGTGGGCATCTTCTCGAGAAGATGCCCACAAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173833
SCARA5 MISSION shRNA shRNA Plasmid DNA
scavenger receptor class A, member 5 (putative)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-436s1c1
Sequence:CCGGCCATCTGTGAGGATTCCTTTGCTCGAGCAAAGGAATCCTCACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173833.2-590s1c1
Sequence:CCGGCTTCCTGATTCTTGTGGGCATCTCGAGATGCCCACAAGAATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1727s1c1
Sequence:CCGGGCCACATTTCTAGAGGTGTCACTCGAGTGACACCTCTAGAAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-489s1c1
Sequence:CCGGGAGGATGGTCCATGTCACAAACTCGAGTTTGTGACATGGACCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-1530s1c1
Sequence:CCGGGATGCCAGTAAGGACATTCTGCTCGAGCAGAATGTCCTTACTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173833.2-1806s1c1
Sequence:CCGGGCTGGTATAATCTCTGTGCCTCTCGAGAGGCACAGAGATTATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-582s1c1
Sequence:CCGGCTGCTGGTCTTCCTGATTCTTCTCGAGAAGAATCAGGAAGACCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-671s1c1
Sequence:CCGGCAATGTGAACCGGCTGAATGACTCGAGTCATTCAGCCGGTTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1690s1c1
Sequence:CCGGGTCTAGCAAGAGATGCTGATACTCGAGTATCAGCATCTCTTGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-607s1c1
Sequence:CCGGGCATCTTCATCTTAGCAGTGTCTCGAGACACTGCTAAGATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1728s1c1
Sequence:CCGGCCACATTTCTAGAGGTGTCATCTCGAGATGACACCTCTAGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173833.2-593s1c1
Sequence:CCGGCCTGATTCTTGTGGGCATCTTCTCGAGAAGATGCCCACAAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173833
SCARA5 MISSION shRNA Lentiviral Transduction Particles
scavenger receptor class A, member 5 (putative)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-436s1c1
Sequence:CCGGCCATCTGTGAGGATTCCTTTGCTCGAGCAAAGGAATCCTCACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173833.2-590s1c1
Sequence:CCGGCTTCCTGATTCTTGTGGGCATCTCGAGATGCCCACAAGAATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1727s1c1
Sequence:CCGGGCCACATTTCTAGAGGTGTCACTCGAGTGACACCTCTAGAAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-489s1c1
Sequence:CCGGGAGGATGGTCCATGTCACAAACTCGAGTTTGTGACATGGACCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-1530s1c1
Sequence:CCGGGATGCCAGTAAGGACATTCTGCTCGAGCAGAATGTCCTTACTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173833.2-1806s1c1
Sequence:CCGGGCTGGTATAATCTCTGTGCCTCTCGAGAGGCACAGAGATTATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-582s1c1
Sequence:CCGGCTGCTGGTCTTCCTGATTCTTCTCGAGAAGAATCAGGAAGACCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-671s1c1
Sequence:CCGGCAATGTGAACCGGCTGAATGACTCGAGTCATTCAGCCGGTTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1690s1c1
Sequence:CCGGGTCTAGCAAGAGATGCTGATACTCGAGTATCAGCATCTCTTGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173833.2-607s1c1
Sequence:CCGGGCATCTTCATCTTAGCAGTGTCTCGAGACACTGCTAAGATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173833.2-1728s1c1
Sequence:CCGGCCACATTTCTAGAGGTGTCATCTCGAGATGACACCTCTAGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173833.2-593s1c1
Sequence:CCGGCCTGATTCTTGTGGGCATCTTCTCGAGAAGATGCCCACAAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks