EMAIL THIS PAGE TO A FRIEND

SCARB2

scavenger receptor class B, member 2

Synonyms: AMRF CD36L2 EPM4 HLGP85 LGP85 LIMP-2 LIMPII SR-BII
UniProtKB ID: Q14108, B4DKD8, E7EM68, Q53Y63
Gene ID:
Human(950) Summary: The protein encoded by this gene is a type III glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes. Earlier studies in mice and rat suggested that this protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. The protein deficiency in mice was reported to impair cell membrane transport processes and cause pelvic junction obstruction, deafness, and peripheral neuropathy. Further studies in human showed that this protein is a ubiquitously expressed protein and that it is involved in the pathogenesis of HFMD (hand, foot, and mouth disease) caused by enterovirus-71 and possibly by coxsackievirus A16. Mutations in this gene caused an autosomal recessive progressive myoclonic epilepsy-4 (EPM4), also known as action myoclonus-renal failure syndrome (AMRF). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
Mouse(12492) scavenger receptor class B, member 2
Rat(117106) scavenger receptor class B, member 2
cow(533177) scavenger receptor class B, member 2
sheep(101105502) scavenger receptor class B, member 2
Domestic Rabbit(100352345) scavenger receptor class B, member 2
naked mole-rat(101715798) scavenger receptor class B, member 2
domestic guinea pig(100716020) scavenger receptor class B, member 2
Zebrafish(192340) scavenger receptor class B, member 2
domestic cat(101098789) scavenger receptor class B, member 2
dog(478435) scavenger receptor class B, member 2
chicken(422638) scavenger receptor class B, member 2
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005506 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005506 Rosetta Predictions human pricing
NM_054001 Rosetta Predictions rat pricing
NM_007644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228314 predicted 1515
2 SASI_Hs01_00228315 predicted 1484
3 SASI_Hs02_00339714 predicted 1616
4 SASI_Hs01_00228316 predicted 867
5 SASI_Hs01_00228317 predicted 1118
6 SASI_Hs01_00228318 predicted 470
7 SASI_Hs01_00228319 predicted 955
8 SASI_Hs01_00228320 predicted 1324
9 SASI_Hs01_00228321 predicted 1554
10 SASI_Hs01_00228322 predicted 1177
11 SASI_Hs01_00228323 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119226 predicted 388
2 SASI_Rn01_00119227 predicted 565
3 SASI_Rn01_00119228 predicted 1427
4 SASI_Rn01_00119229 predicted 1709
5 SASI_Rn01_00119230 predicted 1358
6 SASI_Rn01_00119231 predicted 1458
7 SASI_Rn01_00119232 predicted 1514
8 SASI_Rn01_00119233 predicted 1264
9 SASI_Rn01_00119234 predicted 1118
10 SASI_Rn01_00119235 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160408 predicted 1441
2 SASI_Mm01_00160409 predicted 407
3 SASI_Mm01_00160410 predicted 1582
4 SASI_Mm02_00312128 predicted 1547
5 SASI_Mm01_00160411 predicted 1566
6 SASI_Mm01_00160414 predicted 1466
7 SASI_Mm01_00160415 predicted 1826
8 SASI_Mm02_00312129 predicted 1283
9 SASI_Mm01_00160416 predicted 574
10 SASI_Mm01_00160417 predicted 833
11 SASI_Mm01_00160412 predicted 619
12 SASI_Mm01_00160413 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005506
SCARB2 MISSION shRNA Bacterial Glycerol Stock
scavenger receptor class B, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1219s21c1
Sequence:CCGGCGGTATAAAGTTCCTGCAGAACTCGAGTTCTGCAGGAACTTTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1043s21c1
Sequence:CCGGCGTCACTTGACTGGTGGATAACTCGAGTTATCCACCAGTCAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1569s21c1
Sequence:CCGGCCTCAATGAGAGTGTTCACATCTCGAGATGTGAACACTCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-439s21c1
Sequence:CCGGGACCAGAGTATCGAGAAGAAACTCGAGTTTCTTCTCGATACTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-915s1c1
Sequence:CCGGGCCCGATATCTCTCCCTATTTCTCGAGAAATAGGGAGAGATATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1569s1c1
Sequence:CCGGCCTCAATGAGAGTGTTCACATCTCGAGATGTGAACACTCTCATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-439s1c1
Sequence:CCGGGACCAGAGTATCGAGAAGAAACTCGAGTTTCTTCTCGATACTCTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1219s1c1
Sequence:CCGGCGGTATAAAGTTCCTGCAGAACTCGAGTTCTGCAGGAACTTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1043s1c1
Sequence:CCGGCGTCACTTGACTGGTGGATAACTCGAGTTATCCACCAGTCAAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005506
SCARB2 MISSION shRNA shRNA Plasmid DNA
scavenger receptor class B, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1219s21c1
Sequence:CCGGCGGTATAAAGTTCCTGCAGAACTCGAGTTCTGCAGGAACTTTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1043s21c1
Sequence:CCGGCGTCACTTGACTGGTGGATAACTCGAGTTATCCACCAGTCAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1569s21c1
Sequence:CCGGCCTCAATGAGAGTGTTCACATCTCGAGATGTGAACACTCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-439s21c1
Sequence:CCGGGACCAGAGTATCGAGAAGAAACTCGAGTTTCTTCTCGATACTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-915s1c1
Sequence:CCGGGCCCGATATCTCTCCCTATTTCTCGAGAAATAGGGAGAGATATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1569s1c1
Sequence:CCGGCCTCAATGAGAGTGTTCACATCTCGAGATGTGAACACTCTCATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-439s1c1
Sequence:CCGGGACCAGAGTATCGAGAAGAAACTCGAGTTTCTTCTCGATACTCTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1219s1c1
Sequence:CCGGCGGTATAAAGTTCCTGCAGAACTCGAGTTCTGCAGGAACTTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1043s1c1
Sequence:CCGGCGTCACTTGACTGGTGGATAACTCGAGTTATCCACCAGTCAAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005506
SCARB2 MISSION shRNA Lentiviral Transduction Particles
scavenger receptor class B, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1219s21c1
Sequence:CCGGCGGTATAAAGTTCCTGCAGAACTCGAGTTCTGCAGGAACTTTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1043s21c1
Sequence:CCGGCGTCACTTGACTGGTGGATAACTCGAGTTATCCACCAGTCAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-1569s21c1
Sequence:CCGGCCTCAATGAGAGTGTTCACATCTCGAGATGTGAACACTCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005506.2-439s21c1
Sequence:CCGGGACCAGAGTATCGAGAAGAAACTCGAGTTTCTTCTCGATACTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-915s1c1
Sequence:CCGGGCCCGATATCTCTCCCTATTTCTCGAGAAATAGGGAGAGATATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1569s1c1
Sequence:CCGGCCTCAATGAGAGTGTTCACATCTCGAGATGTGAACACTCTCATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-439s1c1
Sequence:CCGGGACCAGAGTATCGAGAAGAAACTCGAGTTTCTTCTCGATACTCTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1219s1c1
Sequence:CCGGCGGTATAAAGTTCCTGCAGAACTCGAGTTCTGCAGGAACTTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005506.2-1043s1c1
Sequence:CCGGCGTCACTTGACTGGTGGATAACTCGAGTTATCCACCAGTCAAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007644
VALIDATED
SCARB2 MISSION shRNA Bacterial Glycerol Stock
scavenger receptor class B, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-850s21c1
Sequence:CCGGATCTTGTCCCTCGTCCATATTCTCGAGAATATGGACGAGGGACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-687s21c1
Sequence:CCGGCGTTGACTTGATTAGAACAATCTCGAGATTGTTCTAATCAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-1834s21c1
Sequence:CCGGGCCTGTCAAGAAGGAAACATACTCGAGTATGTTTCCTTCTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-631s21c1
Sequence:CCGGGCTGTCACCAATAAGGCATATCTCGAGATATGCCTTATTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-409s21c1
Sequence:CCGGATCGAGAAGAATATGGTATTACTCGAGTAATACCATATTCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-1835s1c1
Sequence:CCGGGCCTGTCAAGAAGGAAACATACTCGAGTATGTTTCCTTCTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007644.2-688s1c1
Sequence:CCGGCGTTGACTTGATTAGAACAATCTCGAGATTGTTCTAATCAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-1122s1c1
Sequence:CCGGGCAGGTCAGTACATATCACTTCTCGAGAAGTGATATGTACTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007644.2-632s1c1
Sequence:CCGGGCTGTCACCAATAAGGCATATCTCGAGATATGCCTTATTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-898s1c1
Sequence:CCGGCGGCCTGTTCTATGAGAGAAACTCGAGTTTCTCTCATAGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007644
VALIDATED
SCARB2 MISSION shRNA shRNA Plasmid DNA
scavenger receptor class B, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-850s21c1
Sequence:CCGGATCTTGTCCCTCGTCCATATTCTCGAGAATATGGACGAGGGACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-687s21c1
Sequence:CCGGCGTTGACTTGATTAGAACAATCTCGAGATTGTTCTAATCAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-1834s21c1
Sequence:CCGGGCCTGTCAAGAAGGAAACATACTCGAGTATGTTTCCTTCTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-631s21c1
Sequence:CCGGGCTGTCACCAATAAGGCATATCTCGAGATATGCCTTATTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-409s21c1
Sequence:CCGGATCGAGAAGAATATGGTATTACTCGAGTAATACCATATTCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-1835s1c1
Sequence:CCGGGCCTGTCAAGAAGGAAACATACTCGAGTATGTTTCCTTCTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007644.2-688s1c1
Sequence:CCGGCGTTGACTTGATTAGAACAATCTCGAGATTGTTCTAATCAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-1122s1c1
Sequence:CCGGGCAGGTCAGTACATATCACTTCTCGAGAAGTGATATGTACTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007644.2-632s1c1
Sequence:CCGGGCTGTCACCAATAAGGCATATCTCGAGATATGCCTTATTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-898s1c1
Sequence:CCGGCGGCCTGTTCTATGAGAGAAACTCGAGTTTCTCTCATAGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007644
VALIDATED
SCARB2 MISSION shRNA Lentiviral Transduction Particles
scavenger receptor class B, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-850s21c1
Sequence:CCGGATCTTGTCCCTCGTCCATATTCTCGAGAATATGGACGAGGGACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-687s21c1
Sequence:CCGGCGTTGACTTGATTAGAACAATCTCGAGATTGTTCTAATCAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-1834s21c1
Sequence:CCGGGCCTGTCAAGAAGGAAACATACTCGAGTATGTTTCCTTCTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-631s21c1
Sequence:CCGGGCTGTCACCAATAAGGCATATCTCGAGATATGCCTTATTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007644.3-409s21c1
Sequence:CCGGATCGAGAAGAATATGGTATTACTCGAGTAATACCATATTCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-1835s1c1
Sequence:CCGGGCCTGTCAAGAAGGAAACATACTCGAGTATGTTTCCTTCTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007644.2-688s1c1
Sequence:CCGGCGTTGACTTGATTAGAACAATCTCGAGATTGTTCTAATCAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-1122s1c1
Sequence:CCGGGCAGGTCAGTACATATCACTTCTCGAGAAGTGATATGTACTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007644.2-632s1c1
Sequence:CCGGGCTGTCACCAATAAGGCATATCTCGAGATATGCCTTATTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007644.2-898s1c1
Sequence:CCGGCGGCCTGTTCTATGAGAGAAACTCGAGTTTCTCTCATAGAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks