EMAIL THIS PAGE TO A FRIEND

SCCPDH

saccharopine dehydrogenase (putative)

Synonyms: NET11 RP11-439E19.2
UniProtKB ID: Q8NBX0, Q8TAR0, Q9Y363
Gene ID:
Mouse(109232) saccharopine dehydrogenase (putative)
Rat(305021) saccharopine dehydrogenase (putative)
cow(507289) saccharopine dehydrogenase (putative)
sheep(101115141) saccharopine dehydrogenase (putative)
domestic guinea pig(100731395) saccharopine dehydrogenase (putative)
naked mole-rat(101720906) saccharopine dehydrogenase (putative)
chicken(421485) saccharopine dehydrogenase (putative)
domestic cat(101088709) saccharopine dehydrogenase (putative)
dog(480105) saccharopine dehydrogenase (putative)
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142611 MISSION® esiRNA esiRNA human SCCPDH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016002 Rosetta Predictions human pricing
NM_001013985 Rosetta Predictions rat pricing
NM_178653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079639 predicted 1353
2 SASI_Hs01_00079640 predicted 825
3 SASI_Hs01_00079641 predicted 1149
4 SASI_Hs01_00079642 predicted 1653
5 SASI_Hs01_00079644 predicted 605
6 SASI_Hs01_00079645 predicted 616
7 SASI_Hs01_00079647 predicted 1603
8 SASI_Hs02_00348681 predicted 1047
9 SASI_Hs01_00079648 predicted 569
10 SASI_Hs02_00348682 predicted 1161
11 SASI_Hs01_00079643 predicted 1100
12 SASI_Hs01_00079646 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090410 predicted 1105
2 SASI_Rn01_00090411 predicted 855
3 SASI_Rn01_00090412 predicted 582
4 SASI_Rn01_00090413 predicted 771
5 SASI_Rn01_00090414 predicted 1097
6 SASI_Rn01_00090416 predicted 677
7 SASI_Rn01_00090417 predicted 1020
8 SASI_Rn01_00090418 predicted 635
9 SASI_Rn01_00090419 predicted 859
10 SASI_Rn02_00201337 predicted 917
11 SASI_Rn01_00090415 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194829 predicted 1138
2 SASI_Mm01_00194830 predicted 367
3 SASI_Mm01_00194831 predicted 730
4 SASI_Mm01_00194832 predicted 690
5 SASI_Mm01_00194834 predicted 836
6 SASI_Mm01_00194835 predicted 868
7 SASI_Mm02_00349083 predicted 787
8 SASI_Mm01_00194836 predicted 599
9 SASI_Mm01_00194837 predicted 1373
10 SASI_Mm01_00194838 predicted 333
11 SASI_Mm01_00194833 predicted 1000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016002
VALIDATED
SCCPDH MISSION shRNA Bacterial Glycerol Stock
saccharopine dehydrogenase (putative)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-469s1c1
Sequence:CCGGCCAGCAGATCTGGGAGTAATACTCGAGTATTACTCCCAGATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-939s1c1
Sequence:CCGGGTTCTTCTCCTTTGGCTATTTCTCGAGAAATAGCCAAAGGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016002.1-848s1c1
Sequence:CCGGCCTCTGTTATTAAGCTGATGTCTCGAGACATCAGCTTAATAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016002.1-697s1c1
Sequence:CCGGCCAATTTCTTATTGTCGGGAACTCGAGTTCCCGACAATAAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016002.1-746s1c1
Sequence:CCGGGATCTGATGTGTCTGTTGTAACTCGAGTTACAACAGACACATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-1233s1c1
Sequence:CCGGCAGACTCAACAAACACGGTATCTCGAGATACCGTGTTTGTTGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-409s1c1
Sequence:CCGGCATGAGAAAGCTGCAGACAAACTCGAGTTTGTCTGCAGCTTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-201s1c1
Sequence:CCGGGTCATCTGAAGTTGGAATCATCTCGAGATGATTCCAACTTCAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-1246s1c1
Sequence:CCGGCACGGTATTGAGTTTAGTGTTCTCGAGAACACTAAACTCAATACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-268s1c1
Sequence:CCGGCAGGCAACAGTTGTCCTCAATCTCGAGATTGAGGACAACTGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-819s21c1
Sequence:CCGGCCAGCAGATCTGGGAGTAATACTCGAGTATTACTCCCAGATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-1289s21c1
Sequence:CCGGGTTCTTCTCCTTTGGCTATTTCTCGAGAAATAGCCAAAGGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-551s21c1
Sequence:CCGGGTCATCTGAAGTTGGAATCATCTCGAGATGATTCCAACTTCAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-1096s21c1
Sequence:CCGGGATCTGATGTGTCTGTTGTAACTCGAGTTACAACAGACACATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016002
VALIDATED
SCCPDH MISSION shRNA shRNA Plasmid DNA
saccharopine dehydrogenase (putative)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-469s1c1
Sequence:CCGGCCAGCAGATCTGGGAGTAATACTCGAGTATTACTCCCAGATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-939s1c1
Sequence:CCGGGTTCTTCTCCTTTGGCTATTTCTCGAGAAATAGCCAAAGGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016002.1-848s1c1
Sequence:CCGGCCTCTGTTATTAAGCTGATGTCTCGAGACATCAGCTTAATAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016002.1-697s1c1
Sequence:CCGGCCAATTTCTTATTGTCGGGAACTCGAGTTCCCGACAATAAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016002.1-746s1c1
Sequence:CCGGGATCTGATGTGTCTGTTGTAACTCGAGTTACAACAGACACATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-1233s1c1
Sequence:CCGGCAGACTCAACAAACACGGTATCTCGAGATACCGTGTTTGTTGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-409s1c1
Sequence:CCGGCATGAGAAAGCTGCAGACAAACTCGAGTTTGTCTGCAGCTTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-201s1c1
Sequence:CCGGGTCATCTGAAGTTGGAATCATCTCGAGATGATTCCAACTTCAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-1246s1c1
Sequence:CCGGCACGGTATTGAGTTTAGTGTTCTCGAGAACACTAAACTCAATACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-268s1c1
Sequence:CCGGCAGGCAACAGTTGTCCTCAATCTCGAGATTGAGGACAACTGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-819s21c1
Sequence:CCGGCCAGCAGATCTGGGAGTAATACTCGAGTATTACTCCCAGATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-1289s21c1
Sequence:CCGGGTTCTTCTCCTTTGGCTATTTCTCGAGAAATAGCCAAAGGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-551s21c1
Sequence:CCGGGTCATCTGAAGTTGGAATCATCTCGAGATGATTCCAACTTCAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-1096s21c1
Sequence:CCGGGATCTGATGTGTCTGTTGTAACTCGAGTTACAACAGACACATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016002
VALIDATED
SCCPDH MISSION shRNA Lentiviral Transduction Particles
saccharopine dehydrogenase (putative)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-469s1c1
Sequence:CCGGCCAGCAGATCTGGGAGTAATACTCGAGTATTACTCCCAGATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-939s1c1
Sequence:CCGGGTTCTTCTCCTTTGGCTATTTCTCGAGAAATAGCCAAAGGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016002.1-848s1c1
Sequence:CCGGCCTCTGTTATTAAGCTGATGTCTCGAGACATCAGCTTAATAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016002.1-697s1c1
Sequence:CCGGCCAATTTCTTATTGTCGGGAACTCGAGTTCCCGACAATAAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016002.1-746s1c1
Sequence:CCGGGATCTGATGTGTCTGTTGTAACTCGAGTTACAACAGACACATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-1233s1c1
Sequence:CCGGCAGACTCAACAAACACGGTATCTCGAGATACCGTGTTTGTTGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-409s1c1
Sequence:CCGGCATGAGAAAGCTGCAGACAAACTCGAGTTTGTCTGCAGCTTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016002.1-201s1c1
Sequence:CCGGGTCATCTGAAGTTGGAATCATCTCGAGATGATTCCAACTTCAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-1246s1c1
Sequence:CCGGCACGGTATTGAGTTTAGTGTTCTCGAGAACACTAAACTCAATACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016002.1-268s1c1
Sequence:CCGGCAGGCAACAGTTGTCCTCAATCTCGAGATTGAGGACAACTGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-819s21c1
Sequence:CCGGCCAGCAGATCTGGGAGTAATACTCGAGTATTACTCCCAGATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-1289s21c1
Sequence:CCGGGTTCTTCTCCTTTGGCTATTTCTCGAGAAATAGCCAAAGGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-551s21c1
Sequence:CCGGGTCATCTGAAGTTGGAATCATCTCGAGATGATTCCAACTTCAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016002.2-1096s21c1
Sequence:CCGGGATCTGATGTGTCTGTTGTAACTCGAGTTACAACAGACACATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178653
VALIDATED
SCCPDH MISSION shRNA Bacterial Glycerol Stock
saccharopine dehydrogenase (putative)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178653.2-1200s1c1
Sequence:CCGGCCGAATCTGCACTCAAGTGAACTCGAGTTCACTTGAGTGCAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-1609s1c1
Sequence:CCGGGAGGAAACTAACATTCTCCTTCTCGAGAAGGAGAATGTTAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-844s1c1
Sequence:CCGGGAGCTGAACTCGTATTCCATTCTCGAGAATGGAATACGAGTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-766s1c1
Sequence:CCGGCGGAGTGTATCATGTCTGAAACTCGAGTTTCAGACATGATACACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178653
VALIDATED
SCCPDH MISSION shRNA shRNA Plasmid DNA
saccharopine dehydrogenase (putative)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178653.2-1200s1c1
Sequence:CCGGCCGAATCTGCACTCAAGTGAACTCGAGTTCACTTGAGTGCAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-1609s1c1
Sequence:CCGGGAGGAAACTAACATTCTCCTTCTCGAGAAGGAGAATGTTAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-844s1c1
Sequence:CCGGGAGCTGAACTCGTATTCCATTCTCGAGAATGGAATACGAGTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-766s1c1
Sequence:CCGGCGGAGTGTATCATGTCTGAAACTCGAGTTTCAGACATGATACACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178653
VALIDATED
SCCPDH MISSION shRNA Lentiviral Transduction Particles
saccharopine dehydrogenase (putative)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178653.2-1200s1c1
Sequence:CCGGCCGAATCTGCACTCAAGTGAACTCGAGTTCACTTGAGTGCAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-1609s1c1
Sequence:CCGGGAGGAAACTAACATTCTCCTTCTCGAGAAGGAGAATGTTAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-844s1c1
Sequence:CCGGGAGCTGAACTCGTATTCCATTCTCGAGAATGGAATACGAGTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178653.2-766s1c1
Sequence:CCGGCGGAGTGTATCATGTCTGAAACTCGAGTTTCAGACATGATACACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks