EMAIL THIS PAGE TO A FRIEND

SCD

stearoyl-CoA desaturase (delta-9-desaturase)

Synonyms: FADS5 MSTP008 SCD1 SCDOS
Gene ID:
Human(6319) Summary: This gene encodes an enzyme involved in fatty acid biosynthesis, primarily the synthesis of oleic acid. Transcripts of approximately 3.9 and 5.2 kb, differing only by alternative polyadenlyation signals, have been detected. A gene encoding a similar enzyme is located on chromosome 4 and a pseudogene of this gene is located on chromosome 17. [provided by RefSeq, Feb 2012]
Rat(83792) stearoyl-CoA desaturase (delta-9-desaturase)
fruit fly(252579) sex combs distal
Horse(100060485) stearoyl-CoA desaturase (delta-9-desaturase)
domestic cat(101091403) stearoyl-CoA desaturase (delta-9-desaturase)
dog(486839) stearoyl-CoA desaturase (delta-9-desaturase)
chicken(395706) stearoyl-CoA desaturase (delta-9-desaturase)
Zebrafish(386661) stearoyl-CoA desaturase (delta-9-desaturase)
domestic guinea pig(100719661) stearoyl-CoA desaturase (delta-9-desaturase)
cow(280924) stearoyl-CoA desaturase (delta-9-desaturase)
sheep(443185) stearoyl-CoA desaturase (delta-9-desaturase)
194 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005063 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108071 MISSION® esiRNA esiRNA human SCD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005063 Rosetta Predictions human pricing
NM_031841 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181371 predicted 1247
2 SASI_Hs01_00181372 predicted 1303
3 SASI_Hs01_00181373 predicted 508
4 SASI_Hs01_00181374 predicted 1421
5 SASI_Hs01_00181375 predicted 612
6 SASI_Hs01_00181376 predicted 1430
7 SASI_Hs01_00181377 predicted 705
8 SASI_Hs01_00181378 predicted 575
9 SASI_Hs01_00181379 predicted 1045
10 SASI_Hs02_00338879 predicted 1383
11 SASI_Hs01_00181380 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080852 predicted 466
2 SASI_Rn01_00080853 predicted 1523
3 SASI_Rn02_00265346 predicted 646
4 SASI_Rn01_00080855 predicted 1469
5 SASI_Rn01_00080856 predicted 424
6 SASI_Rn01_00080857 predicted 1485
7 SASI_Rn01_00080858 predicted 1462
8 SASI_Rn01_00080859 predicted 1490
9 SASI_Rn01_00080861 predicted 468
10 SASI_Rn02_00265347 predicted 360
11 SASI_Rn01_00080854 predicted 353
12 SASI_Rn01_00080860 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005063
VALIDATED
SCD MISSION shRNA Bacterial Glycerol Stock
stearoyl-CoA desaturase (delta-9-desaturase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005063.4-1822s21c1
Sequence:CCGGATCGCCCTCCTTTCCCTTATTCTCGAGAATAAGGGAAAGGAGGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-659s21c1
Sequence:CCGGCCCACCTACAAGGATAAGGAACTCGAGTTCCTTATCCTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-765s21c1
Sequence:CCGGTGATTCCTACCTGCAAGTTCTCTCGAGAGAACTTGCAGGTAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-1310s21c1
Sequence:CCGGCGTCCTTATGACAAGAACATTCTCGAGAATGTTCTTGTCATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-890s21c1
Sequence:CCGGCTACGGCTCTTTCTGATCATTCTCGAGAATGATCAGAAAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-780s1c1
Sequence:CCGGCTACGGCTCTTTCTGATCATTCTCGAGAATGATCAGAAAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005063.3-549s1c1
Sequence:CCGGCCCACCTACAAGGATAAGGAACTCGAGTTCCTTATCCTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-1325s1c1
Sequence:CCGGGCACATCAACTTCACCACATTCTCGAGAATGTGGTGAAGTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-1200s1c1
Sequence:CCGGCGTCCTTATGACAAGAACATTCTCGAGAATGTTCTTGTCATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005063.3-755s1c1
Sequence:CCGGCCGCTCTTACAAAGCTCGGCTCTCGAGAGCCGAGCTTTGTAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005063
VALIDATED
SCD MISSION shRNA shRNA Plasmid DNA
stearoyl-CoA desaturase (delta-9-desaturase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005063.4-1822s21c1
Sequence:CCGGATCGCCCTCCTTTCCCTTATTCTCGAGAATAAGGGAAAGGAGGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-659s21c1
Sequence:CCGGCCCACCTACAAGGATAAGGAACTCGAGTTCCTTATCCTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-765s21c1
Sequence:CCGGTGATTCCTACCTGCAAGTTCTCTCGAGAGAACTTGCAGGTAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-1310s21c1
Sequence:CCGGCGTCCTTATGACAAGAACATTCTCGAGAATGTTCTTGTCATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-890s21c1
Sequence:CCGGCTACGGCTCTTTCTGATCATTCTCGAGAATGATCAGAAAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-780s1c1
Sequence:CCGGCTACGGCTCTTTCTGATCATTCTCGAGAATGATCAGAAAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005063.3-549s1c1
Sequence:CCGGCCCACCTACAAGGATAAGGAACTCGAGTTCCTTATCCTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-1325s1c1
Sequence:CCGGGCACATCAACTTCACCACATTCTCGAGAATGTGGTGAAGTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-1200s1c1
Sequence:CCGGCGTCCTTATGACAAGAACATTCTCGAGAATGTTCTTGTCATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005063.3-755s1c1
Sequence:CCGGCCGCTCTTACAAAGCTCGGCTCTCGAGAGCCGAGCTTTGTAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005063
VALIDATED
SCD MISSION shRNA Lentiviral Transduction Particles
stearoyl-CoA desaturase (delta-9-desaturase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005063.4-1822s21c1
Sequence:CCGGATCGCCCTCCTTTCCCTTATTCTCGAGAATAAGGGAAAGGAGGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-659s21c1
Sequence:CCGGCCCACCTACAAGGATAAGGAACTCGAGTTCCTTATCCTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-765s21c1
Sequence:CCGGTGATTCCTACCTGCAAGTTCTCTCGAGAGAACTTGCAGGTAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-1310s21c1
Sequence:CCGGCGTCCTTATGACAAGAACATTCTCGAGAATGTTCTTGTCATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005063.4-890s21c1
Sequence:CCGGCTACGGCTCTTTCTGATCATTCTCGAGAATGATCAGAAAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-780s1c1
Sequence:CCGGCTACGGCTCTTTCTGATCATTCTCGAGAATGATCAGAAAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005063.3-549s1c1
Sequence:CCGGCCCACCTACAAGGATAAGGAACTCGAGTTCCTTATCCTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-1325s1c1
Sequence:CCGGGCACATCAACTTCACCACATTCTCGAGAATGTGGTGAAGTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005063.3-1200s1c1
Sequence:CCGGCGTCCTTATGACAAGAACATTCTCGAGAATGTTCTTGTCATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005063.3-755s1c1
Sequence:CCGGCCGCTCTTACAAAGCTCGGCTCTCGAGAGCCGAGCTTTGTAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks