EMAIL THIS PAGE TO A FRIEND

SCG3

secretogranin III

Synonyms: SGIII
Gene ID:
Human(29106) Summary: The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(20255) secretogranin III
Rat(116635) secretogranin III
Zebrafish(393730) secretogranin III
chicken(415424) secretogranin III
dog(478307) secretogranin III
domestic cat(101094424) secretogranin III
Horse(100055140) secretogranin III
naked mole-rat(101704377) secretogranin III
Domestic Rabbit(100343331) secretogranin III
domestic guinea pig(100721897) secretogranin III
cow(525941) secretogranin III
sheep(101104667) secretogranin III
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013243 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013243 Rosetta Predictions human pricing
NM_053856 Rosetta Predictions rat pricing
NM_009130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226659 predicted 1181
2 SASI_Hs01_00226660 predicted 1006
3 SASI_Hs01_00226661 predicted 938
4 SASI_Hs02_00344447 predicted 1364
5 SASI_Hs02_00344448 predicted 1445
6 SASI_Hs02_00344449 predicted 489
7 SASI_Hs01_00226665 predicted 912
8 SASI_Hs02_00344450 predicted 1289
9 SASI_Hs01_00226666 predicted 1088
10 SASI_Hs01_00226668 predicted 434
11 SASI_Hs01_00226662 predicted 1016
12 SASI_Hs01_00226663 predicted 923
13 SASI_Hs01_00226664 predicted 1154
14 SASI_Hs01_00226667 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046258 predicted 1565
2 SASI_Rn01_00046259 predicted 822
3 SASI_Rn01_00046260 predicted 1243
4 SASI_Rn01_00046261 predicted 386
5 SASI_Rn02_00266720 predicted 1729
6 SASI_Rn01_00046263 predicted 798
7 SASI_Rn01_00046264 predicted 798
8 SASI_Rn01_00046265 predicted 1010
9 SASI_Rn01_00046266 predicted 1684
10 SASI_Rn01_00046267 predicted 1781
11 SASI_Rn01_00046262 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109680 predicted 496
2 SASI_Mm01_00109681 predicted 1301
3 SASI_Mm01_00109682 predicted 743
4 SASI_Mm01_00109683 predicted 1037
5 SASI_Mm02_00315419 predicted 1353
6 SASI_Mm01_00109685 predicted 1779
7 SASI_Mm01_00109686 predicted 1233
8 SASI_Mm01_00109687 predicted 820
9 SASI_Mm01_00109688 predicted 1110
10 SASI_Mm02_00315420 predicted 1687
11 SASI_Mm01_00109684 predicted 412
12 SASI_Mm01_00109689 predicted 1600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009130
SCG3 MISSION shRNA Bacterial Glycerol Stock
secretogranin III
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-825s21c1
Sequence:CCGGAGAACGACAGAGGAGTGTTTGCTCGAGCAAACACTCCTCTGTCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-1662s21c1
Sequence:CCGGACCAACAAGCTGACGCTTATGCTCGAGCATAAGCGTCAGCTTGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009130.3-1892s21c1
Sequence:CCGGTAGAGCTCTCTTGCCATAAATCTCGAGATTTATGGCAAGAGAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-1204s1c1
Sequence:CCGGCCATCATGAAGACATTGATTGCTCGAGCAATCAATGTCTTCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-720s1c1
Sequence:CCGGCAACTGGATGGAACTCCTTTACTCGAGTAAAGGAGTTCCATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-447s1c1
Sequence:CCGGGCAGAGGCAGACAAGATTAAACTCGAGTTTAATCTTGTCTGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-649s21c1
Sequence:CCGGGAACGTGGAAGACGCTGATTCCTCGAGGAATCAGCGTCTTCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-504s1c1
Sequence:CCGGGCAATTATTCTTCTGTCGATACTCGAGTATCGACAGAAGAATAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009130.1-1924s1c1
Sequence:CCGGGAATCCTTATTTCCTCTTGAACTCGAGTTCAAGAGGAAATAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-760s1c1
Sequence:CCGGCCATAAGATTGCCACCAGGATCTCGAGATCCTGGTGGCAATCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009130.1-1731s1c1
Sequence:CCGGCCTTCCTGTTGTTCCAGCAAACTCGAGTTTGCTGGAACAACAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-1154s1c1
Sequence:CCGGCTGACAAGCATCGACTCAGAACTCGAGTTCTGAGTCGATGCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.1-602s1c1
Sequence:CCGGGATAACCAACTGAACGTGGAACTCGAGTTCCACGTTCAGTTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009130
SCG3 MISSION shRNA shRNA Plasmid DNA
secretogranin III
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-825s21c1
Sequence:CCGGAGAACGACAGAGGAGTGTTTGCTCGAGCAAACACTCCTCTGTCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-1662s21c1
Sequence:CCGGACCAACAAGCTGACGCTTATGCTCGAGCATAAGCGTCAGCTTGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009130.3-1892s21c1
Sequence:CCGGTAGAGCTCTCTTGCCATAAATCTCGAGATTTATGGCAAGAGAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-1204s1c1
Sequence:CCGGCCATCATGAAGACATTGATTGCTCGAGCAATCAATGTCTTCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-720s1c1
Sequence:CCGGCAACTGGATGGAACTCCTTTACTCGAGTAAAGGAGTTCCATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-447s1c1
Sequence:CCGGGCAGAGGCAGACAAGATTAAACTCGAGTTTAATCTTGTCTGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-649s21c1
Sequence:CCGGGAACGTGGAAGACGCTGATTCCTCGAGGAATCAGCGTCTTCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-504s1c1
Sequence:CCGGGCAATTATTCTTCTGTCGATACTCGAGTATCGACAGAAGAATAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009130.1-1924s1c1
Sequence:CCGGGAATCCTTATTTCCTCTTGAACTCGAGTTCAAGAGGAAATAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-760s1c1
Sequence:CCGGCCATAAGATTGCCACCAGGATCTCGAGATCCTGGTGGCAATCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009130.1-1731s1c1
Sequence:CCGGCCTTCCTGTTGTTCCAGCAAACTCGAGTTTGCTGGAACAACAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-1154s1c1
Sequence:CCGGCTGACAAGCATCGACTCAGAACTCGAGTTCTGAGTCGATGCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.1-602s1c1
Sequence:CCGGGATAACCAACTGAACGTGGAACTCGAGTTCCACGTTCAGTTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009130
SCG3 MISSION shRNA Lentiviral Transduction Particles
secretogranin III
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-825s21c1
Sequence:CCGGAGAACGACAGAGGAGTGTTTGCTCGAGCAAACACTCCTCTGTCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-1662s21c1
Sequence:CCGGACCAACAAGCTGACGCTTATGCTCGAGCATAAGCGTCAGCTTGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009130.3-1892s21c1
Sequence:CCGGTAGAGCTCTCTTGCCATAAATCTCGAGATTTATGGCAAGAGAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-1204s1c1
Sequence:CCGGCCATCATGAAGACATTGATTGCTCGAGCAATCAATGTCTTCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-720s1c1
Sequence:CCGGCAACTGGATGGAACTCCTTTACTCGAGTAAAGGAGTTCCATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.2-447s1c1
Sequence:CCGGGCAGAGGCAGACAAGATTAAACTCGAGTTTAATCTTGTCTGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009130.3-649s21c1
Sequence:CCGGGAACGTGGAAGACGCTGATTCCTCGAGGAATCAGCGTCTTCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-504s1c1
Sequence:CCGGGCAATTATTCTTCTGTCGATACTCGAGTATCGACAGAAGAATAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009130.1-1924s1c1
Sequence:CCGGGAATCCTTATTTCCTCTTGAACTCGAGTTCAAGAGGAAATAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-760s1c1
Sequence:CCGGCCATAAGATTGCCACCAGGATCTCGAGATCCTGGTGGCAATCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009130.1-1731s1c1
Sequence:CCGGCCTTCCTGTTGTTCCAGCAAACTCGAGTTTGCTGGAACAACAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009130.1-1154s1c1
Sequence:CCGGCTGACAAGCATCGACTCAGAACTCGAGTTCTGAGTCGATGCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009130.1-602s1c1
Sequence:CCGGGATAACCAACTGAACGTGGAACTCGAGTTCCACGTTCAGTTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013243
SCG3 MISSION shRNA Bacterial Glycerol Stock
secretogranin III
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013243.2-930s21c1
Sequence:CCGGACTACTTAATCTCGGCCTTATCTCGAGATAAGGCCGAGATTAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013243.2-2202s21c1
Sequence:CCGGACCTTGCAGAGCGTGTCTATTCTCGAGAATAGACACGCTCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013243.2-777s21c1
Sequence:CCGGTAAGAGTGGATTGGATCATAACTCGAGTTATGATCCAATCCACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013243.2-2611s1c1
Sequence:CCGGCCAGGCAGTAAGGTAGAAATACTCGAGTATTTCTACCTTACTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-905s1c1
Sequence:CCGGCCGTGTTTGACAAGATTGTTTCTCGAGAAACAATCTTGTCAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-1704s1c1
Sequence:CCGGCCTTTCAAAGATGAGAGACTTCTCGAGAAGTCTCTCATCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-1021s1c1
Sequence:CCGGGCCAACAATTATGAGGAGGATCTCGAGATCCTCCTCATAATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-485s1c1
Sequence:CCGGGCCAAGACAAATCTCTACATACTCGAGTATGTAGAGATTTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013243
SCG3 MISSION shRNA shRNA Plasmid DNA
secretogranin III
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013243.2-930s21c1
Sequence:CCGGACTACTTAATCTCGGCCTTATCTCGAGATAAGGCCGAGATTAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013243.2-2202s21c1
Sequence:CCGGACCTTGCAGAGCGTGTCTATTCTCGAGAATAGACACGCTCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013243.2-777s21c1
Sequence:CCGGTAAGAGTGGATTGGATCATAACTCGAGTTATGATCCAATCCACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013243.2-2611s1c1
Sequence:CCGGCCAGGCAGTAAGGTAGAAATACTCGAGTATTTCTACCTTACTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-905s1c1
Sequence:CCGGCCGTGTTTGACAAGATTGTTTCTCGAGAAACAATCTTGTCAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-1704s1c1
Sequence:CCGGCCTTTCAAAGATGAGAGACTTCTCGAGAAGTCTCTCATCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-1021s1c1
Sequence:CCGGGCCAACAATTATGAGGAGGATCTCGAGATCCTCCTCATAATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-485s1c1
Sequence:CCGGGCCAAGACAAATCTCTACATACTCGAGTATGTAGAGATTTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013243
SCG3 MISSION shRNA Lentiviral Transduction Particles
secretogranin III
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013243.2-930s21c1
Sequence:CCGGACTACTTAATCTCGGCCTTATCTCGAGATAAGGCCGAGATTAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013243.2-2202s21c1
Sequence:CCGGACCTTGCAGAGCGTGTCTATTCTCGAGAATAGACACGCTCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013243.2-777s21c1
Sequence:CCGGTAAGAGTGGATTGGATCATAACTCGAGTTATGATCCAATCCACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013243.2-2611s1c1
Sequence:CCGGCCAGGCAGTAAGGTAGAAATACTCGAGTATTTCTACCTTACTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-905s1c1
Sequence:CCGGCCGTGTTTGACAAGATTGTTTCTCGAGAAACAATCTTGTCAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-1704s1c1
Sequence:CCGGCCTTTCAAAGATGAGAGACTTCTCGAGAAGTCTCTCATCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-1021s1c1
Sequence:CCGGGCCAACAATTATGAGGAGGATCTCGAGATCCTCCTCATAATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013243.2-485s1c1
Sequence:CCGGGCCAAGACAAATCTCTACATACTCGAGTATGTAGAGATTTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks