EMAIL THIS PAGE TO A FRIEND

SCIMP

SLP adaptor and CSK interacting membrane protein

Synonyms: C17orf87 UNQ5783
UniProtKB ID: Q6UWF3, B4DLK1, Q96MD0
Gene ID:
Human(388325) Summary: This gene encodes a transmembrane adaptor protein that is expressed in antigen-presenting cells and is localized in the immunologic synapse. The encoded protein is involved in major histocompatibility complex class II signal transduction and immune synapse formation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(327957) SLP adaptor and CSK interacting membrane protein
Rat(691993) SLP adaptor and CSK interacting membrane protein
domestic guinea pig(100718931) SLP adaptor and CSK interacting membrane protein
naked mole-rat(101723173) SLP adaptor and CSK interacting membrane protein
cow(100848290) SLP adaptor and CSK interacting membrane protein
domestic cat(101090559) SLP adaptor and CSK interacting membrane protein
dog(607322) SLP adaptor and CSK interacting membrane protein
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA006117 Anti-SCIMP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207103 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207103 Rosetta Predictions human pricing
XM_001080739 Rosetta Predictions rat pricing
NM_001045526 Rosetta Predictions mouse pricing
XM_001001775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373731 predicted 378
2 SASI_Hs02_00373732 predicted 332
3 SASI_Hs01_00213921 predicted 348
4 SASI_Hs01_00213922 predicted 230
5 SASI_Hs01_00213924 predicted 421
6 SASI_Hs02_00373733 predicted 339
7 SASI_Hs02_00373734 predicted 242
8 SASI_Hs02_00373735 predicted 409
9 SASI_Hs01_00213925 predicted 200
10 SASI_Hs02_00373736 predicted 398
11 SASI_Hs01_00213918 predicted 592
12 SASI_Hs01_00213919 predicted 627
13 SASI_Hs01_00213920 predicted 209
14 SASI_Hs01_00213923 predicted 554
15 SASI_Hs01_00213926 predicted 594
16 SASI_Hs01_00213927 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369140 predicted 285
2 SASI_Rn02_00369141 predicted 398
3 SASI_Rn02_00369142 predicted 415
4 SASI_Rn02_00369143 predicted 263
5 SASI_Rn02_00369144 predicted 380
6 SASI_Rn02_00369145 predicted 293
7 SASI_Rn02_00369146 predicted 443
8 SASI_Rn02_00369147 predicted 329
9 SASI_Rn02_00369148 predicted 409
10 SASI_Rn02_00369149 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291614 predicted 373
2 SASI_Mm02_00291615 predicted 553
3 SASI_Mm02_00291616 predicted 382
4 SASI_Mm02_00291617 predicted 373
5 SASI_Mm02_00291618 predicted 607
6 SASI_Mm02_00291619 predicted 294
7 SASI_Mm02_00291620 predicted 270
8 SASI_Mm02_00291621 predicted 206
9 SASI_Mm02_00291622 predicted 704
10 SASI_Mm02_00291623 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206848 predicted 1012
2 SASI_Mm01_00206849 predicted 589
3 SASI_Mm01_00206850 predicted 927
4 SASI_Mm01_00206851 predicted 234
5 SASI_Mm01_00206852 predicted 644
6 SASI_Mm01_00206853 predicted 326
7 SASI_Mm01_00206854 predicted 978
8 SASI_Mm01_00206855 predicted 305
9 SASI_Mm01_00206856 predicted 241
10 SASI_Mm01_00206857 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207103
SCIMP MISSION shRNA Bacterial Glycerol Stock
SLP adaptor and CSK interacting membrane protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-762s1c1
Sequence:CCGGCTTGTGCTGTTGAGGAAACTTCTCGAGAAGTTTCCTCAACAGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-584s1c1
Sequence:CCGGCAATCAAGAATGGTTGAACTTCTCGAGAAGTTCAACCATTCTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-469s1c1
Sequence:CCGGGAAGATGACTATGACGATGTTCTCGAGAACATCGTCATAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-484s1c1
Sequence:CCGGGATGTTGAAATCCCTGCAAATCTCGAGATTTGCAGGGATTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-472s1c1
Sequence:CCGGGATGACTATGACGATGTTGAACTCGAGTTCAACATCGTCATAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-767s1c1
Sequence:CCGGGCTGTTGAGGAAACTTTCCATCTCGAGATGGAAAGTTTCCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-301s1c1
Sequence:CCGGGTTCTTAATGAGTCGCCAGTTCTCGAGAACTGGCGACTCATTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-399s1c1
Sequence:CCGGCGCTACATACTCACTGGTAAACTCGAGTTTACCAGTGAGTATGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-483s1c1
Sequence:CCGGCGATGTTGAAATCCCTGCAAACTCGAGTTTGCAGGGATTTCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207103
SCIMP MISSION shRNA shRNA Plasmid DNA
SLP adaptor and CSK interacting membrane protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-762s1c1
Sequence:CCGGCTTGTGCTGTTGAGGAAACTTCTCGAGAAGTTTCCTCAACAGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-584s1c1
Sequence:CCGGCAATCAAGAATGGTTGAACTTCTCGAGAAGTTCAACCATTCTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-469s1c1
Sequence:CCGGGAAGATGACTATGACGATGTTCTCGAGAACATCGTCATAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-484s1c1
Sequence:CCGGGATGTTGAAATCCCTGCAAATCTCGAGATTTGCAGGGATTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-472s1c1
Sequence:CCGGGATGACTATGACGATGTTGAACTCGAGTTCAACATCGTCATAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-767s1c1
Sequence:CCGGGCTGTTGAGGAAACTTTCCATCTCGAGATGGAAAGTTTCCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-301s1c1
Sequence:CCGGGTTCTTAATGAGTCGCCAGTTCTCGAGAACTGGCGACTCATTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-399s1c1
Sequence:CCGGCGCTACATACTCACTGGTAAACTCGAGTTTACCAGTGAGTATGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-483s1c1
Sequence:CCGGCGATGTTGAAATCCCTGCAAACTCGAGTTTGCAGGGATTTCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207103
SCIMP MISSION shRNA Lentiviral Transduction Particles
SLP adaptor and CSK interacting membrane protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-762s1c1
Sequence:CCGGCTTGTGCTGTTGAGGAAACTTCTCGAGAAGTTTCCTCAACAGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-584s1c1
Sequence:CCGGCAATCAAGAATGGTTGAACTTCTCGAGAAGTTCAACCATTCTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-469s1c1
Sequence:CCGGGAAGATGACTATGACGATGTTCTCGAGAACATCGTCATAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-484s1c1
Sequence:CCGGGATGTTGAAATCCCTGCAAATCTCGAGATTTGCAGGGATTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-472s1c1
Sequence:CCGGGATGACTATGACGATGTTGAACTCGAGTTCAACATCGTCATAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207103.1-767s1c1
Sequence:CCGGGCTGTTGAGGAAACTTTCCATCTCGAGATGGAAAGTTTCCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-301s1c1
Sequence:CCGGGTTCTTAATGAGTCGCCAGTTCTCGAGAACTGGCGACTCATTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-399s1c1
Sequence:CCGGCGCTACATACTCACTGGTAAACTCGAGTTTACCAGTGAGTATGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207103.1-483s1c1
Sequence:CCGGCGATGTTGAAATCCCTGCAAACTCGAGTTTGCAGGGATTTCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045526
SCIMP MISSION shRNA Bacterial Glycerol Stock
SLP adaptor and CSK interacting membrane protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-516s21c1
Sequence:CCGGTGGCAAGCTGAAGTGGGTTTACTCGAGTAAACCCACTTCAGCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-483s21c1
Sequence:CCGGACCGAAACCCAGCACTCTAAACTCGAGTTTAGAGTGCTGGGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-403s21c1
Sequence:CCGGTTAGGAACAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTGTTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-207s21c1
Sequence:CCGGCAAGGCAGGAACTGGGAAATTCTCGAGAATTTCCCAGTTCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045526.2-556s21c1
Sequence:CCGGCTCTAGAATAGCCGGATTATACTCGAGTATAATCCGGCTATTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045526
SCIMP MISSION shRNA shRNA Plasmid DNA
SLP adaptor and CSK interacting membrane protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-516s21c1
Sequence:CCGGTGGCAAGCTGAAGTGGGTTTACTCGAGTAAACCCACTTCAGCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-483s21c1
Sequence:CCGGACCGAAACCCAGCACTCTAAACTCGAGTTTAGAGTGCTGGGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-403s21c1
Sequence:CCGGTTAGGAACAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTGTTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-207s21c1
Sequence:CCGGCAAGGCAGGAACTGGGAAATTCTCGAGAATTTCCCAGTTCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045526.2-556s21c1
Sequence:CCGGCTCTAGAATAGCCGGATTATACTCGAGTATAATCCGGCTATTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045526
SCIMP MISSION shRNA Lentiviral Transduction Particles
SLP adaptor and CSK interacting membrane protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-516s21c1
Sequence:CCGGTGGCAAGCTGAAGTGGGTTTACTCGAGTAAACCCACTTCAGCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-483s21c1
Sequence:CCGGACCGAAACCCAGCACTCTAAACTCGAGTTTAGAGTGCTGGGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-403s21c1
Sequence:CCGGTTAGGAACAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTGTTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045526.2-207s21c1
Sequence:CCGGCAAGGCAGGAACTGGGAAATTCTCGAGAATTTCCCAGTTCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045526.2-556s21c1
Sequence:CCGGCTCTAGAATAGCCGGATTATACTCGAGTATAATCCGGCTATTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks