EMAIL THIS PAGE TO A FRIEND

SCML2

sex comb on midleg-like 2 (Drosophila)

UniProtKB ID: Q9UQR0, Q5JXE6, Q86U98, Q8IWD0, Q8NDP2, Q9UGC5
Gene ID:
Human(10389) Summary: This gene encodes a member of the Polycomb group proteins. These proteins form the Polycomb repressive complexes which are involved in transcriptional repression. The encoded protein binds histone peptides that are monomethylated at lysine residues and may be involved in regulating homeotic gene expression during development. [provided by RefSeq, Jun 2010]
Mouse(107815) sex comb on midleg-like 2 (Drosophila)
Zebrafish(559561) sex comb on midleg-like 2 (Drosophila)
Horse(100057593) sex comb on midleg-like 2 (Drosophila)
domestic cat(101099691) sex comb on midleg-like 2 (Drosophila)
dog(480855) sex comb on midleg-like 2 (Drosophila)
chicken(418613) sex comb on midleg-like 2 (Drosophila)
domestic guinea pig(100718755) sex comb on midleg-like 2 (Drosophila)
naked mole-rat(101712011) sex comb on midleg-like 2 (Drosophila)
cow(523477) sex comb on midleg-like 2 (Drosophila)
sheep(101108022) sex comb on midleg-like 2 (Drosophila)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083001 MISSION® esiRNA esiRNA human SCML2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006089 Rosetta Predictions human pricing
NM_133194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084914 predicted 2209
2 SASI_Hs01_00084915 predicted 610
3 SASI_Hs01_00084916 predicted 1696
4 SASI_Hs02_00340868 predicted 2193
5 SASI_Hs01_00084918 predicted 1718
6 SASI_Hs01_00084919 predicted 250
7 SASI_Hs01_00084920 predicted 738
8 SASI_Hs01_00084921 predicted 364
9 SASI_Hs01_00084922 predicted 2139
10 SASI_Hs01_00084923 predicted 2012
11 SASI_Hs01_00084917 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338377 predicted 3066
2 SASI_Mm02_00338378 predicted 3058
3 SASI_Mm01_00196675 predicted 1096
4 SASI_Mm01_00196677 predicted 754
5 SASI_Mm02_00338379 predicted 2831
6 SASI_Mm01_00196678 predicted 1200
7 SASI_Mm01_00196680 predicted 1075
8 SASI_Mm01_00196683 predicted 530
9 SASI_Mm01_00196684 predicted 748
10 SASI_Mm02_00338380 predicted 1137
11 SASI_Mm01_00196676 predicted 574
12 SASI_Mm01_00196679 predicted 611
13 SASI_Mm01_00196681 predicted 573
14 SASI_Mm01_00196682 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006089
VALIDATED
SCML2 MISSION shRNA Bacterial Glycerol Stock
sex comb on midleg-like 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-1875s1c1
Sequence:CCGGCCCATGAAGTTAAATTCCAAACTCGAGTTTGGAATTTAACTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-665s1c1
Sequence:CCGGGCGACCATTGGAGATGTTAAACTCGAGTTTAACATCTCCAATGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-560s1c1
Sequence:CCGGGCCACATTATTTAAGAAGGAACTCGAGTTCCTTCTTAAATAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-1589s1c1
Sequence:CCGGCCTCAGCAAACTGTACCATATCTCGAGATATGGTACAGTTTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006089.2-2495s21c1
Sequence:CCGGACAGGTTAGTATTGGCATATTCTCGAGAATATGCCAATACTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-997s21c1
Sequence:CCGGCAGGAGATCAAGTCGAATTAACTCGAGTTAATTCGACTTGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-254s21c1
Sequence:CCGGTTCCACTGGGAGGAGTATTTGCTCGAGCAAATACTCCTCCCAGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-395s21c1
Sequence:CCGGGTATGTATTGCTACGGTTATTCTCGAGAATAACCGTAGCAATACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006089.2-1469s21c1
Sequence:CCGGCCAGTGAACAGTGCATCATTTCTCGAGAAATGATGCACTGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006089
VALIDATED
SCML2 MISSION shRNA shRNA Plasmid DNA
sex comb on midleg-like 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-1875s1c1
Sequence:CCGGCCCATGAAGTTAAATTCCAAACTCGAGTTTGGAATTTAACTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-665s1c1
Sequence:CCGGGCGACCATTGGAGATGTTAAACTCGAGTTTAACATCTCCAATGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-560s1c1
Sequence:CCGGGCCACATTATTTAAGAAGGAACTCGAGTTCCTTCTTAAATAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-1589s1c1
Sequence:CCGGCCTCAGCAAACTGTACCATATCTCGAGATATGGTACAGTTTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006089.2-2495s21c1
Sequence:CCGGACAGGTTAGTATTGGCATATTCTCGAGAATATGCCAATACTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-997s21c1
Sequence:CCGGCAGGAGATCAAGTCGAATTAACTCGAGTTAATTCGACTTGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-254s21c1
Sequence:CCGGTTCCACTGGGAGGAGTATTTGCTCGAGCAAATACTCCTCCCAGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-395s21c1
Sequence:CCGGGTATGTATTGCTACGGTTATTCTCGAGAATAACCGTAGCAATACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006089.2-1469s21c1
Sequence:CCGGCCAGTGAACAGTGCATCATTTCTCGAGAAATGATGCACTGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006089
VALIDATED
SCML2 MISSION shRNA Lentiviral Transduction Particles
sex comb on midleg-like 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-1875s1c1
Sequence:CCGGCCCATGAAGTTAAATTCCAAACTCGAGTTTGGAATTTAACTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-665s1c1
Sequence:CCGGGCGACCATTGGAGATGTTAAACTCGAGTTTAACATCTCCAATGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-560s1c1
Sequence:CCGGGCCACATTATTTAAGAAGGAACTCGAGTTCCTTCTTAAATAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006089.1-1589s1c1
Sequence:CCGGCCTCAGCAAACTGTACCATATCTCGAGATATGGTACAGTTTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006089.2-2495s21c1
Sequence:CCGGACAGGTTAGTATTGGCATATTCTCGAGAATATGCCAATACTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-997s21c1
Sequence:CCGGCAGGAGATCAAGTCGAATTAACTCGAGTTAATTCGACTTGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-254s21c1
Sequence:CCGGTTCCACTGGGAGGAGTATTTGCTCGAGCAAATACTCCTCCCAGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006089.2-395s21c1
Sequence:CCGGGTATGTATTGCTACGGTTATTCTCGAGAATAACCGTAGCAATACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006089.2-1469s21c1
Sequence:CCGGCCAGTGAACAGTGCATCATTTCTCGAGAAATGATGCACTGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133194
SCML2 MISSION shRNA Bacterial Glycerol Stock
sex comb on midleg-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133194.2-2627s1c1
Sequence:CCGGGCCTTCTTTGATGGGAAAGTTCTCGAGAACTTTCCCATCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-613s1c1
Sequence:CCGGGCAGTGTTCTTTAAGGAGGAACTCGAGTTCCTCCTTAAAGAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-2241s1c1
Sequence:CCGGCCCTAAGAAGGGCATTACTATCTCGAGATAGTAATGCCCTTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-2081s1c1
Sequence:CCGGCCTCTGAACAACCAAAGTCTTCTCGAGAAGACTTTGGTTGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-568s1c1
Sequence:CCGGCCCATGTTCTTACTACGTGTACTCGAGTACACGTAGTAAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133194
SCML2 MISSION shRNA shRNA Plasmid DNA
sex comb on midleg-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133194.2-2627s1c1
Sequence:CCGGGCCTTCTTTGATGGGAAAGTTCTCGAGAACTTTCCCATCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-613s1c1
Sequence:CCGGGCAGTGTTCTTTAAGGAGGAACTCGAGTTCCTCCTTAAAGAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-2241s1c1
Sequence:CCGGCCCTAAGAAGGGCATTACTATCTCGAGATAGTAATGCCCTTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-2081s1c1
Sequence:CCGGCCTCTGAACAACCAAAGTCTTCTCGAGAAGACTTTGGTTGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-568s1c1
Sequence:CCGGCCCATGTTCTTACTACGTGTACTCGAGTACACGTAGTAAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133194
SCML2 MISSION shRNA Lentiviral Transduction Particles
sex comb on midleg-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133194.2-2627s1c1
Sequence:CCGGGCCTTCTTTGATGGGAAAGTTCTCGAGAACTTTCCCATCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-613s1c1
Sequence:CCGGGCAGTGTTCTTTAAGGAGGAACTCGAGTTCCTCCTTAAAGAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-2241s1c1
Sequence:CCGGCCCTAAGAAGGGCATTACTATCTCGAGATAGTAATGCCCTTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-2081s1c1
Sequence:CCGGCCTCTGAACAACCAAAGTCTTCTCGAGAAGACTTTGGTTGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133194.2-568s1c1
Sequence:CCGGCCCATGTTCTTACTACGTGTACTCGAGTACACGTAGTAAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks