EMAIL THIS PAGE TO A FRIEND

SCML4

sex comb on midleg-like 4 (Drosophila)

Synonyms: dJ47M23.1
Gene ID:
Mouse(268297) sex comb on midleg-like 4 (Drosophila)
Rat(309859) sex comb on midleg-like 4 (Drosophila)
Zebrafish(654771) sex comb on midleg-like 4 (Drosophila)
Horse(100072084) sex comb on midleg-like 4 (Drosophila)
domestic cat(101093687) sex comb on midleg-like 4 (Drosophila)
dog(481951) sex comb on midleg-like 4 (Drosophila)
chicken(428626) sex comb on midleg-like 4 (Drosophila)
cow(535263) sex comb on midleg-like 4 (Drosophila)
sheep(101118704) sex comb on midleg-like 4 (Drosophila)
naked mole-rat(101702233) sex comb on midleg-like 4 (Drosophila)
domestic guinea pig(100728401) sex comb on midleg-like 4 (Drosophila)
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198081 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198081 Rosetta Predictions human pricing
NM_001107638 Rosetta Predictions rat pricing
NM_172938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371629 predicted 1525
2 SASI_Hs02_00371630 predicted 1532
3 SASI_Hs02_00371631 predicted 306
4 SASI_Hs01_00030260 predicted 916
5 SASI_Hs02_00371632 predicted 1396
6 SASI_Hs02_00371633 predicted 1440
7 SASI_Hs01_00030259 predicted 1199
8 SASI_Hs02_00371634 predicted 1555
9 SASI_Hs02_00371635 predicted 737
10 SASI_Hs02_00371636 predicted 1189
11 SASI_Hs01_00030261 predicted 1005
12 SASI_Hs01_00030262 predicted 313
13 SASI_Hs01_00030263 predicted 491
14 SASI_Hs01_00030264 predicted 991
15 SASI_Hs01_00030265 predicted 208
16 SASI_Hs01_00030266 predicted 336
17 SASI_Hs01_00030267 predicted 416
18 SASI_Hs01_00030268 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230805 predicted 1279
2 SASI_Rn02_00230806 predicted 599
3 SASI_Rn02_00230807 predicted 1328
4 SASI_Rn02_00230808 predicted 821
5 SASI_Rn02_00230809 predicted 1229
6 SASI_Rn02_00230810 predicted 353
7 SASI_Rn02_00230811 predicted 669
8 SASI_Rn02_00230812 predicted 1279
9 SASI_Rn02_00230813 predicted 1198
10 SASI_Rn02_00230814 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344946 predicted 1459
2 SASI_Mm02_00344947 predicted 1477
3 SASI_Mm02_00344948 predicted 1375
4 SASI_Mm02_00344949 predicted 994
5 SASI_Mm02_00344950 predicted 1566
6 SASI_Mm02_00344951 predicted 549
7 SASI_Mm02_00344952 predicted 969
8 SASI_Mm02_00344953 predicted 342
9 SASI_Mm02_00344954 predicted 863
10 SASI_Mm02_00344955 predicted 1481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198081
SCML4 MISSION shRNA Bacterial Glycerol Stock
sex comb on midleg-like 4 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-1450s21c1
Sequence:CCGGTGAAACTCTGCTACCACATTGCTCGAGCAATGTGGTAGCAGAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-295s21c1
Sequence:CCGGCACTTCACTCCACGCCTATGACTCGAGTCATAGGCGTGGAGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198081.3-2537s21c1
Sequence:CCGGAGTTGTATCTGTGGCTAATTTCTCGAGAAATTAGCCACAGATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-784s21c1
Sequence:CCGGTGGTGAACAGCATCGGCTATGCTCGAGCATAGCCGATGCTGTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-319s21c1
Sequence:CCGGTGGCAGTTCATAACCTTTATTCTCGAGAATAAAGGTTATGAACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198081.1-984s1c1
Sequence:CCGGCAGATGTGGTAATGTAATGCACTCGAGTGCATTACATTACCACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198081.1-1818s1c1
Sequence:CCGGGCCATAGAGTATAGTGGATAACTCGAGTTATCCACTATACTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198081.1-976s1c1
Sequence:CCGGGAAGGAAACAGATGTGGTAATCTCGAGATTACCACATCTGTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198081
SCML4 MISSION shRNA shRNA Plasmid DNA
sex comb on midleg-like 4 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-1450s21c1
Sequence:CCGGTGAAACTCTGCTACCACATTGCTCGAGCAATGTGGTAGCAGAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-295s21c1
Sequence:CCGGCACTTCACTCCACGCCTATGACTCGAGTCATAGGCGTGGAGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198081.3-2537s21c1
Sequence:CCGGAGTTGTATCTGTGGCTAATTTCTCGAGAAATTAGCCACAGATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-784s21c1
Sequence:CCGGTGGTGAACAGCATCGGCTATGCTCGAGCATAGCCGATGCTGTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-319s21c1
Sequence:CCGGTGGCAGTTCATAACCTTTATTCTCGAGAATAAAGGTTATGAACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198081.1-984s1c1
Sequence:CCGGCAGATGTGGTAATGTAATGCACTCGAGTGCATTACATTACCACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198081.1-1818s1c1
Sequence:CCGGGCCATAGAGTATAGTGGATAACTCGAGTTATCCACTATACTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198081.1-976s1c1
Sequence:CCGGGAAGGAAACAGATGTGGTAATCTCGAGATTACCACATCTGTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198081
SCML4 MISSION shRNA Lentiviral Transduction Particles
sex comb on midleg-like 4 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-1450s21c1
Sequence:CCGGTGAAACTCTGCTACCACATTGCTCGAGCAATGTGGTAGCAGAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-295s21c1
Sequence:CCGGCACTTCACTCCACGCCTATGACTCGAGTCATAGGCGTGGAGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198081.3-2537s21c1
Sequence:CCGGAGTTGTATCTGTGGCTAATTTCTCGAGAAATTAGCCACAGATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-784s21c1
Sequence:CCGGTGGTGAACAGCATCGGCTATGCTCGAGCATAGCCGATGCTGTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198081.3-319s21c1
Sequence:CCGGTGGCAGTTCATAACCTTTATTCTCGAGAATAAAGGTTATGAACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198081.1-984s1c1
Sequence:CCGGCAGATGTGGTAATGTAATGCACTCGAGTGCATTACATTACCACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198081.1-1818s1c1
Sequence:CCGGGCCATAGAGTATAGTGGATAACTCGAGTTATCCACTATACTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198081.1-976s1c1
Sequence:CCGGGAAGGAAACAGATGTGGTAATCTCGAGATTACCACATCTGTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172938
SCML4 MISSION shRNA Bacterial Glycerol Stock
sex comb on midleg-like 4 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172938.2-2826s1c1
Sequence:CCGGCCCTTGACAATAGTATGAATTCTCGAGAATTCATACTATTGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-345s1c1
Sequence:CCGGGCCGTCCATAACCTCTATTCTCTCGAGAGAATAGAGGTTATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-1362s1c1
Sequence:CCGGCTCTTCAGAAAGCACGAGATTCTCGAGAATCTCGTGCTTTCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-1465s1c1
Sequence:CCGGGCTATCACATTGACAAGCTAACTCGAGTTAGCTTGTCAATGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-346s1c1
Sequence:CCGGCCGTCCATAACCTCTATTCTACTCGAGTAGAATAGAGGTTATGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172938
SCML4 MISSION shRNA shRNA Plasmid DNA
sex comb on midleg-like 4 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172938.2-2826s1c1
Sequence:CCGGCCCTTGACAATAGTATGAATTCTCGAGAATTCATACTATTGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-345s1c1
Sequence:CCGGGCCGTCCATAACCTCTATTCTCTCGAGAGAATAGAGGTTATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-1362s1c1
Sequence:CCGGCTCTTCAGAAAGCACGAGATTCTCGAGAATCTCGTGCTTTCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-1465s1c1
Sequence:CCGGGCTATCACATTGACAAGCTAACTCGAGTTAGCTTGTCAATGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-346s1c1
Sequence:CCGGCCGTCCATAACCTCTATTCTACTCGAGTAGAATAGAGGTTATGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172938
SCML4 MISSION shRNA Lentiviral Transduction Particles
sex comb on midleg-like 4 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172938.2-2826s1c1
Sequence:CCGGCCCTTGACAATAGTATGAATTCTCGAGAATTCATACTATTGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-345s1c1
Sequence:CCGGGCCGTCCATAACCTCTATTCTCTCGAGAGAATAGAGGTTATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-1362s1c1
Sequence:CCGGCTCTTCAGAAAGCACGAGATTCTCGAGAATCTCGTGCTTTCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-1465s1c1
Sequence:CCGGGCTATCACATTGACAAGCTAACTCGAGTTAGCTTGTCAATGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172938.2-346s1c1
Sequence:CCGGCCGTCCATAACCTCTATTCTACTCGAGTAGAATAGAGGTTATGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks