EMAIL THIS PAGE TO A FRIEND

SCYL3

SCY1-like 3 (S. cerevisiae)

Synonyms: PACE-1 PACE1
Gene ID:
Human(57147) Summary: This gene encodes a protein with a kinase domain and four HEAT repeats. The encoded protein interacts with the C-terminal domain of ezrin, an ERM protein, and may play a role in cell adhesion and migration. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]
Mouse(240880) SCY1-like 3 (S. cerevisiae)
Rat(360866) SCY1-like 3 (S. cerevisiae)
Zebrafish(323839) SCY1-like 3 (S. cerevisiae)
chicken(424396) SCY1-like 3 (S. cerevisiae)
Horse(100051897) SCY1-like 3 (S. cerevisiae)
domestic cat(101084081) SCY1-like 3 (S. cerevisiae)
dog(480077) SCY1-like 3 (S. cerevisiae)
cow(506600) SCY1-like 3 (S. cerevisiae)
sheep(101102577) SCY1-like 3 (S. cerevisiae)
domestic guinea pig(100718206) SCY1-like 3 (S. cerevisiae)
naked mole-rat(101705003) SCY1-like 3 (S. cerevisiae)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020423 Rosetta Predictions human pricing
NM_181093 Rosetta Predictions human pricing
XM_001075015 Rosetta Predictions rat pricing
XM_341142 Rosetta Predictions rat pricing
NM_028776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353429 predicted 701
2 SASI_Hs01_00243622 predicted 649
3 SASI_Hs02_00353430 predicted 1867
4 SASI_Hs01_00243624 predicted 1034
5 SASI_Hs02_00353431 predicted 705
6 SASI_Hs02_00353432 predicted 1160
7 SASI_Hs01_00243625 predicted 828
8 SASI_Hs01_00243626 predicted 616
9 SASI_Hs02_00353433 predicted 1760
10 SASI_Hs01_00243627 predicted 404
11 SASI_Hs01_00243623 predicted 521
12 SASI_Hs01_00243628 predicted 485
13 SASI_Hs01_00243629 predicted 830
14 SASI_Hs01_00243630 predicted 739
15 SASI_Hs01_00243631 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369939 predicted 709
2 SASI_Hs01_00067664 predicted 655
3 SASI_Hs02_00369940 predicted 2023
4 SASI_Hs01_00067666 predicted 1034
5 SASI_Hs02_00369941 predicted 711
6 SASI_Hs02_00369942 predicted 1167
7 SASI_Hs01_00067667 predicted 823
8 SASI_Hs01_00067668 predicted 617
9 SASI_Hs02_00369943 predicted 1919
10 SASI_Hs01_00067669 predicted 405
11 SASI_Hs01_00067665 predicted 418
12 SASI_Hs01_00067670 predicted 376
13 SASI_Hs01_00067671 predicted 719
14 SASI_Hs01_00067672 predicted 637
15 SASI_Hs01_00067673 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348120 predicted 1497
2 SASI_Rn02_00348121 predicted 1280
3 SASI_Rn02_00348122 predicted 2758
4 SASI_Rn02_00348123 predicted 1735
5 SASI_Rn02_00348124 predicted 1315
6 SASI_Rn02_00348125 predicted 2501
7 SASI_Rn02_00348126 predicted 641
8 SASI_Rn02_00348127 predicted 2767
9 SASI_Rn02_00348128 predicted 2542
10 SASI_Rn02_00348129 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392463 predicted 291
2 SASI_Rn02_00392464 predicted 312
3 SASI_Rn02_00392465 predicted 281
4 SASI_Rn02_00392466 predicted 227
5 SASI_Rn02_00392467 predicted 285
6 SASI_Rn02_00392468 predicted 327
7 SASI_Rn02_00392469 predicted 362
8 SASI_Rn02_00392470 predicted 282
9 SASI_Rn02_00392471 predicted 216
10 SASI_Rn02_00392472 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120320 predicted 267
2 SASI_Mm02_00334383 predicted 246
3 SASI_Mm01_00120321 predicted 2214
4 SASI_Mm01_00120323 predicted 222
5 SASI_Mm01_00120326 predicted 1102
6 SASI_Mm01_00120327 predicted 916
7 SASI_Mm01_00120328 predicted 1672
8 SASI_Mm01_00120329 predicted 1329
9 SASI_Mm02_00334384 predicted 876
10 SASI_Mm02_00334385 predicted 2293
11 SASI_Mm01_00120322 predicted 1957
12 SASI_Mm01_00120324 predicted 2245
13 SASI_Mm01_00120325 predicted 885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020423
VALIDATED
SCYL3 MISSION shRNA Bacterial Glycerol Stock
SCY1-like 3 (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020423.5-2714s21c1
Sequence:CCGGTTTCCTTAGGCAGCTTATTTACTCGAGTAAATAAGCTGCCTAAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020423.5-900s21c1
Sequence:CCGGAGCGCTCTGCACCTTACTATCCTCGAGGATAGTAAGGTGCAGAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020423.5-500s21c1
Sequence:CCGGGTGCTGGGATCTATGACATATCTCGAGATATGTCATAGATCCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.4-221s1c1
Sequence:CCGGCCTCTGGACTTGCTGTTTATCCTCGAGGATAAACAGCAAGTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020423.4-2366s1c1
Sequence:CCGGCCAACTGAAGTAGGAGACTGACTCGAGTCAGTCTCCTACTTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020423.4-2525s1c1
Sequence:CCGGCCAGGACAATTCCGGAAGTAACTCGAGTTACTTCCGGAATTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.4-1836s1c1
Sequence:CCGGGCCTTGGAAATCAAGCTTACCCTCGAGGGTAAGCTTGATTTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.4-628s1c1
Sequence:CCGGCTGAGGAGTATTCAGTCAATACTCGAGTATTGACTGAATACTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.x-2816s1c1
Sequence:CCGGCCTGTTCTCTAAATGTCAAATCTCGAGATTTGACATTTAGAGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-532s1c1
Sequence:CCGGGTCTGTTTATCATCTGTGTTTCTCGAGAAACACAGATGATAAACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-1310s1c1
Sequence:CCGGGCCTGCGTGATACTAGTGATTCTCGAGAATCACTAGTATCACGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.x-1186s1c1
Sequence:CCGGCTCCAGTTGTTTGAAGTTCATCTCGAGATGAACTTCAAACAACTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-194s1c1
Sequence:CCGGCACTGAGAGAACCACCATTTACTCGAGTAAATGGTGGTTCTCTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020423
VALIDATED
SCYL3 MISSION shRNA shRNA Plasmid DNA
SCY1-like 3 (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020423.5-2714s21c1
Sequence:CCGGTTTCCTTAGGCAGCTTATTTACTCGAGTAAATAAGCTGCCTAAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020423.5-900s21c1
Sequence:CCGGAGCGCTCTGCACCTTACTATCCTCGAGGATAGTAAGGTGCAGAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020423.5-500s21c1
Sequence:CCGGGTGCTGGGATCTATGACATATCTCGAGATATGTCATAGATCCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.4-221s1c1
Sequence:CCGGCCTCTGGACTTGCTGTTTATCCTCGAGGATAAACAGCAAGTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020423.4-2366s1c1
Sequence:CCGGCCAACTGAAGTAGGAGACTGACTCGAGTCAGTCTCCTACTTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020423.4-2525s1c1
Sequence:CCGGCCAGGACAATTCCGGAAGTAACTCGAGTTACTTCCGGAATTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.4-1836s1c1
Sequence:CCGGGCCTTGGAAATCAAGCTTACCCTCGAGGGTAAGCTTGATTTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.4-628s1c1
Sequence:CCGGCTGAGGAGTATTCAGTCAATACTCGAGTATTGACTGAATACTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.x-2816s1c1
Sequence:CCGGCCTGTTCTCTAAATGTCAAATCTCGAGATTTGACATTTAGAGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-532s1c1
Sequence:CCGGGTCTGTTTATCATCTGTGTTTCTCGAGAAACACAGATGATAAACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-1310s1c1
Sequence:CCGGGCCTGCGTGATACTAGTGATTCTCGAGAATCACTAGTATCACGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.x-1186s1c1
Sequence:CCGGCTCCAGTTGTTTGAAGTTCATCTCGAGATGAACTTCAAACAACTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-194s1c1
Sequence:CCGGCACTGAGAGAACCACCATTTACTCGAGTAAATGGTGGTTCTCTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020423
VALIDATED
SCYL3 MISSION shRNA Lentiviral Transduction Particles
SCY1-like 3 (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020423.5-2714s21c1
Sequence:CCGGTTTCCTTAGGCAGCTTATTTACTCGAGTAAATAAGCTGCCTAAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020423.5-900s21c1
Sequence:CCGGAGCGCTCTGCACCTTACTATCCTCGAGGATAGTAAGGTGCAGAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020423.5-500s21c1
Sequence:CCGGGTGCTGGGATCTATGACATATCTCGAGATATGTCATAGATCCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.4-221s1c1
Sequence:CCGGCCTCTGGACTTGCTGTTTATCCTCGAGGATAAACAGCAAGTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020423.4-2366s1c1
Sequence:CCGGCCAACTGAAGTAGGAGACTGACTCGAGTCAGTCTCCTACTTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020423.4-2525s1c1
Sequence:CCGGCCAGGACAATTCCGGAAGTAACTCGAGTTACTTCCGGAATTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.4-1836s1c1
Sequence:CCGGGCCTTGGAAATCAAGCTTACCCTCGAGGGTAAGCTTGATTTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.4-628s1c1
Sequence:CCGGCTGAGGAGTATTCAGTCAATACTCGAGTATTGACTGAATACTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.x-2816s1c1
Sequence:CCGGCCTGTTCTCTAAATGTCAAATCTCGAGATTTGACATTTAGAGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-532s1c1
Sequence:CCGGGTCTGTTTATCATCTGTGTTTCTCGAGAAACACAGATGATAAACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-1310s1c1
Sequence:CCGGGCCTGCGTGATACTAGTGATTCTCGAGAATCACTAGTATCACGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020423.x-1186s1c1
Sequence:CCGGCTCCAGTTGTTTGAAGTTCATCTCGAGATGAACTTCAAACAACTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020423.x-194s1c1
Sequence:CCGGCACTGAGAGAACCACCATTTACTCGAGTAAATGGTGGTTCTCTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028776
VALIDATED
SCYL3 MISSION shRNA Bacterial Glycerol Stock
SCY1-like 3 (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028776.4-1316s21c1
Sequence:CCGGACTACTGGGCCTTCGTGATACCTCGAGGTATCACGAAGGCCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028776.4-2368s21c1
Sequence:CCGGATAACAACTGGTGACGATAATCTCGAGATTATCGTCACCAGTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028776.4-1417s21c1
Sequence:CCGGGAGAACGAACCAAGATCTTTACTCGAGTAAAGATCTTGGTTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-1104s1c1
Sequence:CCGGCCCTATCTACTTGGTCCTAAACTCGAGTTTAGGACCAAGTAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028776.3-1324s1c1
Sequence:CCGGGCCTTCGTGATACCAGCAATTCTCGAGAATTGCTGGTATCACGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028776.3-2181s1c1
Sequence:CCGGGCAGATATGATCCCAGAAATTCTCGAGAATTTCTGGGATCATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-1549s1c1
Sequence:CCGGCGTCTAACGTATTCCCTAAATCTCGAGATTTAGGGAATACGTTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-258s1c1
Sequence:CCGGGCCATATTGCAAGATGGGAAACTCGAGTTTCCCATCTTGCAATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028776
VALIDATED
SCYL3 MISSION shRNA shRNA Plasmid DNA
SCY1-like 3 (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028776.4-1316s21c1
Sequence:CCGGACTACTGGGCCTTCGTGATACCTCGAGGTATCACGAAGGCCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028776.4-2368s21c1
Sequence:CCGGATAACAACTGGTGACGATAATCTCGAGATTATCGTCACCAGTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028776.4-1417s21c1
Sequence:CCGGGAGAACGAACCAAGATCTTTACTCGAGTAAAGATCTTGGTTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-1104s1c1
Sequence:CCGGCCCTATCTACTTGGTCCTAAACTCGAGTTTAGGACCAAGTAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028776.3-1324s1c1
Sequence:CCGGGCCTTCGTGATACCAGCAATTCTCGAGAATTGCTGGTATCACGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028776.3-2181s1c1
Sequence:CCGGGCAGATATGATCCCAGAAATTCTCGAGAATTTCTGGGATCATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-1549s1c1
Sequence:CCGGCGTCTAACGTATTCCCTAAATCTCGAGATTTAGGGAATACGTTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-258s1c1
Sequence:CCGGGCCATATTGCAAGATGGGAAACTCGAGTTTCCCATCTTGCAATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028776
VALIDATED
SCYL3 MISSION shRNA Lentiviral Transduction Particles
SCY1-like 3 (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028776.4-1316s21c1
Sequence:CCGGACTACTGGGCCTTCGTGATACCTCGAGGTATCACGAAGGCCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028776.4-2368s21c1
Sequence:CCGGATAACAACTGGTGACGATAATCTCGAGATTATCGTCACCAGTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028776.4-1417s21c1
Sequence:CCGGGAGAACGAACCAAGATCTTTACTCGAGTAAAGATCTTGGTTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-1104s1c1
Sequence:CCGGCCCTATCTACTTGGTCCTAAACTCGAGTTTAGGACCAAGTAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028776.3-1324s1c1
Sequence:CCGGGCCTTCGTGATACCAGCAATTCTCGAGAATTGCTGGTATCACGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028776.3-2181s1c1
Sequence:CCGGGCAGATATGATCCCAGAAATTCTCGAGAATTTCTGGGATCATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-1549s1c1
Sequence:CCGGCGTCTAACGTATTCCCTAAATCTCGAGATTTAGGGAATACGTTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028776.3-258s1c1
Sequence:CCGGGCCATATTGCAAGATGGGAAACTCGAGTTTCCCATCTTGCAATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks