EMAIL THIS PAGE TO A FRIEND

SDC1

syndecan 1

Synonyms: CD138 SDC SYND1 syndecan
UniProtKB ID: P18827, D6W523, Q53QV0, Q546D3, Q96HB7
Gene ID:
Human(6382) Summary: The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-1 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-1 expression has been detected in several different tumor types. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(20969) syndecan 1
Rat(25216) syndecan 1
cow(529759) syndecan 1
sheep(101106837) syndecan 1
chicken(421960) syndecan 1
dog(482986) syndecan 1
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305991 ANTI-CD138 (C-TERM K281) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB5500039 Anti-CD138 antibody, Rabbit monoclonal clone SP152, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
HPA006185 Anti-SDC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1305542 MONOCLONAL ANTI-CD138 (C-TERMINAL) antibody produced in mouse clone 587CT7.3.6.5, crude ascites, buffered aqueous solution human
flow cytometry, immunofluorescence, western blot pricing
SAB1305543 MONOCLONAL ANTI-CD138 antibody produced in mouse clone 480CT5.4.3, IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, western blot pricing
SAB1305487 MONOCLONAL ANTI-CD138 antibody produced in mouse clone 480CT5.4.3, crude ascites, buffered aqueous solution human
western blot pricing
SAB4700486 Monoclonal Anti-CD138, azide free antibody produced in mouse clone B-A38, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700487 Monoclonal Anti-CD138-FITC antibody produced in mouse clone B-A38, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700488 Monoclonal Anti-CD138-PE antibody produced in mouse clone B-A38, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB0736 Human SDC1 / Syndecan-1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002997 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006946 Rosetta Predictions human pricing
NM_002997 Rosetta Predictions human pricing
NM_013026 Rosetta Predictions rat pricing
NM_011519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030797 predicted 452
2 SASI_Hs01_00030798 predicted 765
3 SASI_Hs02_00305160 predicted 696
4 SASI_Hs02_00305161 predicted 1481
5 SASI_Hs01_00030799 predicted 1199
6 SASI_Hs01_00030801 predicted 1294
7 SASI_Hs02_00305162 predicted 1290
8 SASI_Hs02_00305163 predicted 1365
9 SASI_Hs02_00305164 predicted 594
10 SASI_Hs02_00305165 predicted 450
11 SASI_Hs01_00030792 predicted 1582
12 SASI_Hs01_00030793 predicted 1304
13 SASI_Hs01_00030794 predicted 1592
14 SASI_Hs01_00030795 predicted 452
15 SASI_Hs01_00030796 predicted 1709
16 SASI_Hs01_00030800 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011331 predicted 362
2 SASI_Hs01_00011332 predicted 676
3 SASI_Hs02_00334873 predicted 605
4 SASI_Hs02_00334874 predicted 1389
5 SASI_Hs01_00011333 predicted 1109
6 SASI_Hs01_00011335 predicted 1206
7 SASI_Hs02_00334875 predicted 1203
8 SASI_Hs02_00334876 predicted 1277
9 SASI_Hs02_00334877 predicted 497
10 SASI_Hs02_00334878 predicted 365
11 SASI_Hs01_00011326 predicted 1493
12 SASI_Hs01_00011327 predicted 1209
13 SASI_Hs01_00011328 predicted 1495
14 SASI_Hs01_00011329 predicted 364
15 SASI_Hs01_00011330 predicted 1621
16 SASI_Hs01_00011334 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101113 predicted 1192
2 SASI_Rn02_00260708 predicted 841
3 SASI_Rn02_00260709 predicted 263
4 SASI_Rn01_00101114 predicted 1454
5 SASI_Rn01_00101115 predicted 538
6 SASI_Rn01_00101116 predicted 1522
7 SASI_Rn01_00101117 predicted 1524
8 SASI_Rn01_00101118 predicted 1028
9 SASI_Rn01_00101120 predicted 829
10 SASI_Rn02_00260710 predicted 1023
11 SASI_Rn01_00101119 predicted 1509
12 SASI_Rn01_00101121 predicted 839
13 SASI_Rn01_00101122 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053661 predicted 396
2 SASI_Mm01_00053662 predicted 1363
3 SASI_Mm01_00053663 predicted 298
4 SASI_Mm01_00053664 predicted 1057
5 SASI_Mm01_00053665 predicted 396
6 SASI_Mm01_00053666 predicted 296
7 SASI_Mm01_00053667 predicted 1354
8 SASI_Mm01_00053668 predicted 441
9 SASI_Mm02_00320837 predicted 1268
10 SASI_Mm02_00320838 predicted 1573
11 SASI_Mm01_00053660 predicted 318
12 SASI_Mm01_00053669 predicted 1436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002997
SDC1 MISSION shRNA Bacterial Glycerol Stock
syndecan 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002997.4-1444s21c1
Sequence:CCGGGTTTCTCGCATAGGACCTTTCCTCGAGGAAAGGTCCTATGCGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002997.4-501s21c1
Sequence:CCGGACGCAGCTCCTGACGGCTATTCTCGAGAATAGCCGTCAGGAGCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002997.4-1499s21c1
Sequence:CCGGACTCGGTTTCTCCAAACTGAACTCGAGTTCAGTTTGGAGAAACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002997.4-1560s1c1
Sequence:CCGGCCGACTGCTTTGGACCTAAATCTCGAGATTTAGGTCCAAAGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-363s1c1
Sequence:CCGGCCGCAAATTGTGGCTACTAATCTCGAGATTAGTAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-1118s1c1
Sequence:CCGGCATGCTGTACCGCATGAAGAACTCGAGTTCTTCATGCGGTACAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-455s1c1
Sequence:CCGGGCAAGATATCACCTTGTCACACTCGAGTGTGACAAGGTGATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-921s1c1
Sequence:CCGGGAGCAGGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002997
SDC1 MISSION shRNA shRNA Plasmid DNA
syndecan 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002997.4-1444s21c1
Sequence:CCGGGTTTCTCGCATAGGACCTTTCCTCGAGGAAAGGTCCTATGCGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002997.4-501s21c1
Sequence:CCGGACGCAGCTCCTGACGGCTATTCTCGAGAATAGCCGTCAGGAGCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002997.4-1499s21c1
Sequence:CCGGACTCGGTTTCTCCAAACTGAACTCGAGTTCAGTTTGGAGAAACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002997.4-1560s1c1
Sequence:CCGGCCGACTGCTTTGGACCTAAATCTCGAGATTTAGGTCCAAAGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-363s1c1
Sequence:CCGGCCGCAAATTGTGGCTACTAATCTCGAGATTAGTAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-1118s1c1
Sequence:CCGGCATGCTGTACCGCATGAAGAACTCGAGTTCTTCATGCGGTACAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-455s1c1
Sequence:CCGGGCAAGATATCACCTTGTCACACTCGAGTGTGACAAGGTGATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-921s1c1
Sequence:CCGGGAGCAGGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002997
SDC1 MISSION shRNA Lentiviral Transduction Particles
syndecan 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002997.4-1444s21c1
Sequence:CCGGGTTTCTCGCATAGGACCTTTCCTCGAGGAAAGGTCCTATGCGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002997.4-501s21c1
Sequence:CCGGACGCAGCTCCTGACGGCTATTCTCGAGAATAGCCGTCAGGAGCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002997.4-1499s21c1
Sequence:CCGGACTCGGTTTCTCCAAACTGAACTCGAGTTCAGTTTGGAGAAACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002997.4-1560s1c1
Sequence:CCGGCCGACTGCTTTGGACCTAAATCTCGAGATTTAGGTCCAAAGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-363s1c1
Sequence:CCGGCCGCAAATTGTGGCTACTAATCTCGAGATTAGTAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-1118s1c1
Sequence:CCGGCATGCTGTACCGCATGAAGAACTCGAGTTCTTCATGCGGTACAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-455s1c1
Sequence:CCGGGCAAGATATCACCTTGTCACACTCGAGTGTGACAAGGTGATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002997.4-921s1c1
Sequence:CCGGGAGCAGGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011519
VALIDATED
SDC1 MISSION shRNA Bacterial Glycerol Stock
syndecan 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-865s21c1
Sequence:CCGGGAACAAGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-1072s21c1
Sequence:CCGGCGGATGAAGAAGAAGGACGAACTCGAGTTCGTCCTTCTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011519.2-304s21c1
Sequence:CCGGCCGCAAATTGTGGCTGTAAATCTCGAGATTTACAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011519.2-818s21c1
Sequence:CCGGTCGAGGATGGAACTGCCAATCCTCGAGGATTGGCAGTTCCATCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-1503s21c1
Sequence:CCGGTTGGACCTAGATGGCCTATTGCTCGAGCAATAGGCCATCTAGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-383s1c1
Sequence:CCGGGCACAGGTGCTTTGCCAGATACTCGAGTATCTGGCAAAGCACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-1072s1c1
Sequence:CCGGCGGATGAAGAAGAAGGACGAACTCGAGTTCGTCCTTCTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-792s1c1
Sequence:CCGGCGGCACTTCTGTCATCAAAGACTCGAGTCTTTGATGACAGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-865s1c1
Sequence:CCGGGAACAAGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011519.1-304s1c1
Sequence:CCGGCCGCAAATTGTGGCTGTAAATCTCGAGATTTACAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011519
VALIDATED
SDC1 MISSION shRNA shRNA Plasmid DNA
syndecan 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-865s21c1
Sequence:CCGGGAACAAGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-1072s21c1
Sequence:CCGGCGGATGAAGAAGAAGGACGAACTCGAGTTCGTCCTTCTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011519.2-304s21c1
Sequence:CCGGCCGCAAATTGTGGCTGTAAATCTCGAGATTTACAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011519.2-818s21c1
Sequence:CCGGTCGAGGATGGAACTGCCAATCCTCGAGGATTGGCAGTTCCATCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-1503s21c1
Sequence:CCGGTTGGACCTAGATGGCCTATTGCTCGAGCAATAGGCCATCTAGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-383s1c1
Sequence:CCGGGCACAGGTGCTTTGCCAGATACTCGAGTATCTGGCAAAGCACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-1072s1c1
Sequence:CCGGCGGATGAAGAAGAAGGACGAACTCGAGTTCGTCCTTCTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-792s1c1
Sequence:CCGGCGGCACTTCTGTCATCAAAGACTCGAGTCTTTGATGACAGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-865s1c1
Sequence:CCGGGAACAAGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011519.1-304s1c1
Sequence:CCGGCCGCAAATTGTGGCTGTAAATCTCGAGATTTACAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011519
VALIDATED
SDC1 MISSION shRNA Lentiviral Transduction Particles
syndecan 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-865s21c1
Sequence:CCGGGAACAAGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-1072s21c1
Sequence:CCGGCGGATGAAGAAGAAGGACGAACTCGAGTTCGTCCTTCTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011519.2-304s21c1
Sequence:CCGGCCGCAAATTGTGGCTGTAAATCTCGAGATTTACAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011519.2-818s21c1
Sequence:CCGGTCGAGGATGGAACTGCCAATCCTCGAGGATTGGCAGTTCCATCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011519.2-1503s21c1
Sequence:CCGGTTGGACCTAGATGGCCTATTGCTCGAGCAATAGGCCATCTAGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-383s1c1
Sequence:CCGGGCACAGGTGCTTTGCCAGATACTCGAGTATCTGGCAAAGCACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-1072s1c1
Sequence:CCGGCGGATGAAGAAGAAGGACGAACTCGAGTTCGTCCTTCTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-792s1c1
Sequence:CCGGCGGCACTTCTGTCATCAAAGACTCGAGTCTTTGATGACAGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011519.1-865s1c1
Sequence:CCGGGAACAAGACTTCACCTTTGAACTCGAGTTCAAAGGTGAAGTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011519.1-304s1c1
Sequence:CCGGCCGCAAATTGTGGCTGTAAATCTCGAGATTTACAGCCACAATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks