EMAIL THIS PAGE TO A FRIEND

SDK2

sidekick cell adhesion molecule 2

Gene ID:
Human(54549) Summary: The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(237979) sidekick homolog 2 (chicken)
Rat(360652) sidekick cell adhesion molecule 2
chicken(395215) sidekick homolog 2
dog(483283) sidekick cell adhesion molecule 2
domestic cat(101095058) sidekick cell adhesion molecule 2
Horse(100061116) sidekick cell adhesion molecule 2
cow(100336619) sidekick cell adhesion molecule 2
cow(536209) sidekick homolog 2 (chicken)
sheep(101106954) sidekick cell adhesion molecule 2
naked mole-rat(101720028) sidekick cell adhesion molecule 2
domestic guinea pig(100726095) sidekick cell adhesion molecule 2
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019064 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057511 MISSION® esiRNA esiRNA targeting mouse Sdk2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019064 Rosetta Predictions human pricing
NM_001108303 Rosetta Predictions rat pricing
NM_172800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054582 predicted 3304
2 SASI_Hs01_00054583 predicted 4790
3 SASI_Hs01_00054584 predicted 3565
4 SASI_Hs01_00054585 predicted 4070
5 SASI_Hs01_00054586 predicted 2894
6 SASI_Hs01_00054587 predicted 768
7 SASI_Hs01_00054588 predicted 3606
8 SASI_Hs01_00054589 predicted 4506
9 SASI_Hs01_00054590 predicted 2495
10 SASI_Hs01_00054591 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237329 predicted 4065
2 SASI_Rn02_00237330 predicted 6515
3 SASI_Rn02_00237331 predicted 3942
4 SASI_Rn02_00237332 predicted 4889
5 SASI_Rn02_00237333 predicted 5171
6 SASI_Rn02_00237334 predicted 5392
7 SASI_Rn02_00237335 predicted 2577
8 SASI_Rn02_00237336 predicted 1725
9 SASI_Rn02_00237337 predicted 2882
10 SASI_Rn02_00237338 predicted 3774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067497 predicted 5468
2 SASI_Mm01_00067499 predicted 3776
3 SASI_Mm01_00067500 predicted 4450
4 SASI_Mm01_00067501 predicted 623
5 SASI_Mm01_00067503 predicted 467
6 SASI_Mm01_00067504 predicted 2602
7 SASI_Mm01_00067505 predicted 5653
8 SASI_Mm01_00067506 predicted 1729
9 SASI_Mm02_00344716 predicted 5396
10 SASI_Mm02_00344717 predicted 4285
11 SASI_Mm01_00067498 predicted 5979
12 SASI_Mm01_00067502 predicted 1226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172800
SDK2 MISSION shRNA Bacterial Glycerol Stock
sidekick cell adhesion molecule 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172800.2-5642s21c1
Sequence:CCGGCCCATCACGCGCTACGTAATACTCGAGTATTACGTAGCGCGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172800.2-4308s21c1
Sequence:CCGGTACAGCAGGAAGACGTGAAAGCTCGAGCTTTCACGTCTTCCTGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-2084s1c1
Sequence:CCGGGCTGTCAATGATGTGGGCAAACTCGAGTTTGCCCACATCATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-4870s1c1
Sequence:CCGGCGAGATCCGAATGAGCATATACTCGAGTATATGCTCATTCGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-812s1c1
Sequence:CCGGCCTCTCATCAAGCTGCACATTCTCGAGAATGTGCAGCTTGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-634s1c1
Sequence:CCGGGCAGGCGGTTAATGACAAGAACTCGAGTTCTTGTCATTAACCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-6295s1c1
Sequence:CCGGCCACTCCTTTGTCAACCATTACTCGAGTAATGGTTGACAAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172800
SDK2 MISSION shRNA shRNA Plasmid DNA
sidekick cell adhesion molecule 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172800.2-5642s21c1
Sequence:CCGGCCCATCACGCGCTACGTAATACTCGAGTATTACGTAGCGCGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172800.2-4308s21c1
Sequence:CCGGTACAGCAGGAAGACGTGAAAGCTCGAGCTTTCACGTCTTCCTGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-2084s1c1
Sequence:CCGGGCTGTCAATGATGTGGGCAAACTCGAGTTTGCCCACATCATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-4870s1c1
Sequence:CCGGCGAGATCCGAATGAGCATATACTCGAGTATATGCTCATTCGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-812s1c1
Sequence:CCGGCCTCTCATCAAGCTGCACATTCTCGAGAATGTGCAGCTTGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-634s1c1
Sequence:CCGGGCAGGCGGTTAATGACAAGAACTCGAGTTCTTGTCATTAACCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-6295s1c1
Sequence:CCGGCCACTCCTTTGTCAACCATTACTCGAGTAATGGTTGACAAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172800
SDK2 MISSION shRNA Lentiviral Transduction Particles
sidekick cell adhesion molecule 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172800.2-5642s21c1
Sequence:CCGGCCCATCACGCGCTACGTAATACTCGAGTATTACGTAGCGCGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172800.2-4308s21c1
Sequence:CCGGTACAGCAGGAAGACGTGAAAGCTCGAGCTTTCACGTCTTCCTGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-2084s1c1
Sequence:CCGGGCTGTCAATGATGTGGGCAAACTCGAGTTTGCCCACATCATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-4870s1c1
Sequence:CCGGCGAGATCCGAATGAGCATATACTCGAGTATATGCTCATTCGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-812s1c1
Sequence:CCGGCCTCTCATCAAGCTGCACATTCTCGAGAATGTGCAGCTTGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-634s1c1
Sequence:CCGGGCAGGCGGTTAATGACAAGAACTCGAGTTCTTGTCATTAACCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172800.2-6295s1c1
Sequence:CCGGCCACTCCTTTGTCAACCATTACTCGAGTAATGGTTGACAAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019064
SDK2 MISSION shRNA Bacterial Glycerol Stock
sidekick cell adhesion molecule 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-1482s1c1
Sequence:CCGGCCAGTTCATCAACGGCATCAACTCGAGTTGATGCCGTTGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-3729s1c1
Sequence:CCGGGCTTACCTCCATGTACTCCATCTCGAGATGGAGTACATGGAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-4089s1c1
Sequence:CCGGGCTCAAGAACTTGACTGGCTACTCGAGTAGCCAGTCAAGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019064.2-322s1c1
Sequence:CCGGCCAGCTATCACTTGGCAGAAACTCGAGTTTCTGCCAAGTGATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-5034s1c1
Sequence:CCGGGAACTCTTTCTGCCGAAAGAACTCGAGTTCTTTCGGCAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019064.2-897s1c1
Sequence:CCGGGATCCGCTACATTCTGGAGATCTCGAGATCTCCAGAATGTAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-1569s1c1
Sequence:CCGGGCCTAACTTTCAAGACAGCATCTCGAGATGCTGTCTTGAAAGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019064
SDK2 MISSION shRNA shRNA Plasmid DNA
sidekick cell adhesion molecule 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-1482s1c1
Sequence:CCGGCCAGTTCATCAACGGCATCAACTCGAGTTGATGCCGTTGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-3729s1c1
Sequence:CCGGGCTTACCTCCATGTACTCCATCTCGAGATGGAGTACATGGAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-4089s1c1
Sequence:CCGGGCTCAAGAACTTGACTGGCTACTCGAGTAGCCAGTCAAGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019064.2-322s1c1
Sequence:CCGGCCAGCTATCACTTGGCAGAAACTCGAGTTTCTGCCAAGTGATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-5034s1c1
Sequence:CCGGGAACTCTTTCTGCCGAAAGAACTCGAGTTCTTTCGGCAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019064.2-897s1c1
Sequence:CCGGGATCCGCTACATTCTGGAGATCTCGAGATCTCCAGAATGTAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-1569s1c1
Sequence:CCGGGCCTAACTTTCAAGACAGCATCTCGAGATGCTGTCTTGAAAGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019064
SDK2 MISSION shRNA Lentiviral Transduction Particles
sidekick cell adhesion molecule 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-1482s1c1
Sequence:CCGGCCAGTTCATCAACGGCATCAACTCGAGTTGATGCCGTTGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-3729s1c1
Sequence:CCGGGCTTACCTCCATGTACTCCATCTCGAGATGGAGTACATGGAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-4089s1c1
Sequence:CCGGGCTCAAGAACTTGACTGGCTACTCGAGTAGCCAGTCAAGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019064.2-322s1c1
Sequence:CCGGCCAGCTATCACTTGGCAGAAACTCGAGTTTCTGCCAAGTGATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-5034s1c1
Sequence:CCGGGAACTCTTTCTGCCGAAAGAACTCGAGTTCTTTCGGCAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019064.2-897s1c1
Sequence:CCGGGATCCGCTACATTCTGGAGATCTCGAGATCTCCAGAATGTAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019064.2-1569s1c1
Sequence:CCGGGCCTAACTTTCAAGACAGCATCTCGAGATGCTGTCTTGAAAGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks