EMAIL THIS PAGE TO A FRIEND

SDR39U1

short chain dehydrogenase/reductase family 39U, member 1

Synonyms: C14orf124 HCDI
UniProtKB ID: Q9NRG7, Q6ZW71, Q9BVQ3
Gene ID:
Mouse(654795) short chain dehydrogenase/reductase family 39U, member 1
Rat(361044) short chain dehydrogenase/reductase family 39U, member 1
cow(520897) short chain dehydrogenase/reductase family 39U, member 1
sheep(101112484) short chain dehydrogenase/reductase family 39U, member 1
domestic guinea pig(100729467) short chain dehydrogenase/reductase family 39U, member 1
naked mole-rat(101715328) short chain dehydrogenase/reductase family 39U, member 1
Zebrafish(767637) short chain dehydrogenase/reductase family 39U, member 1
domestic cat(101084544) short chain dehydrogenase/reductase family 39U, member 1
dog(608506) short chain dehydrogenase/reductase family 39U, member 1
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001082975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001082975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001082975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020195 Rosetta Predictions human pricing
NM_001108378 Rosetta Predictions rat pricing
NM_001082975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200166 predicted 369
2 SASI_Hs01_00200167 predicted 225
3 SASI_Hs01_00200169 predicted 955
4 SASI_Hs02_00353124 predicted 288
5 SASI_Hs02_00353125 predicted 994
6 SASI_Hs01_00200170 predicted 636
7 SASI_Hs02_00353126 predicted 685
8 SASI_Hs02_00353127 predicted 815
9 SASI_Hs01_00200172 predicted 701
10 SASI_Hs01_00200174 predicted 335
11 SASI_Hs01_00200168 predicted 647
12 SASI_Hs01_00200171 predicted 1231
13 SASI_Hs01_00200173 predicted 347
14 SASI_Hs01_00200175 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238079 predicted 1182
2 SASI_Rn02_00238080 predicted 1195
3 SASI_Rn02_00238081 predicted 980
4 SASI_Rn02_00238082 predicted 973
5 SASI_Rn02_00238083 predicted 215
6 SASI_Rn02_00238084 predicted 368
7 SASI_Rn02_00238085 predicted 1200
8 SASI_Rn02_00238086 predicted 737
9 SASI_Rn02_00238087 predicted 1090
10 SASI_Rn02_00238088 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299434 predicted 571
2 SASI_Mm02_00299435 predicted 454
3 SASI_Mm02_00299436 predicted 836
4 SASI_Mm02_00299437 predicted 520
5 SASI_Mm02_00299438 predicted 802
6 SASI_Mm02_00299439 predicted 277
7 SASI_Mm02_00299440 predicted 629
8 SASI_Mm02_00299441 predicted 387
9 SASI_Mm02_00299442 predicted 795
10 SASI_Mm02_00299443 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020195
VALIDATED
SDR39U1 MISSION shRNA Bacterial Glycerol Stock
short chain dehydrogenase/reductase family 39U, member 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-344s21c1
Sequence:CCGGCTTAGTCACAGGTGTAGCTTACTCGAGTAAGCTACACCTGTGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-864s21c1
Sequence:CCGGCAGTATTCCTTCCCAGAGCTACTCGAGTAGCTCTGGGAAGGAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020195.2-997s21c1
Sequence:CCGGGCTGAAGCCATCTGGTTCTTACTCGAGTAAGAACCAGATGGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-233s21c1
Sequence:CCGGCCGAAGATGGAATGAAACCTTCTCGAGAAGGTTTCATTCCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020195.1-281s1c1
Sequence:CCGGCCCAACTCCACGGGAATATAACTCGAGTTATATTCCCGTGGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020195.1-1162s1c1
Sequence:CCGGGCTGCCTTAAAGGAAATTGTACTCGAGTACAATTTCCTTTAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-512s1c1
Sequence:CCGGGATGGAATGAAACCTTCCAAACTCGAGTTTGGAAGGTTTCATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-507s1c1
Sequence:CCGGCCGAAGATGGAATGAAACCTTCTCGAGAAGGTTTCATTCCATCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-618s1c1
Sequence:CCGGCTTAGTCACAGGTGTAGCTTACTCGAGTAAGCTACACCTGTGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020195.1-564s1c1
Sequence:CCGGCCAATTGCTGGCTAAAGCCATCTCGAGATGGCTTTAGCCAGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-1271s1c1
Sequence:CCGGGCTGAAGCCATCTGGTTCTTACTCGAGTAAGAACCAGATGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-624s1c1
Sequence:CCGGCACAGGTGTAGCTTACTACCACTCGAGTGGTAGTAAGCTACACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-1138s1c1
Sequence:CCGGCAGTATTCCTTCCCAGAGCTACTCGAGTAGCTCTGGGAAGGAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020195
VALIDATED
SDR39U1 MISSION shRNA shRNA Plasmid DNA
short chain dehydrogenase/reductase family 39U, member 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-344s21c1
Sequence:CCGGCTTAGTCACAGGTGTAGCTTACTCGAGTAAGCTACACCTGTGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-864s21c1
Sequence:CCGGCAGTATTCCTTCCCAGAGCTACTCGAGTAGCTCTGGGAAGGAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020195.2-997s21c1
Sequence:CCGGGCTGAAGCCATCTGGTTCTTACTCGAGTAAGAACCAGATGGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-233s21c1
Sequence:CCGGCCGAAGATGGAATGAAACCTTCTCGAGAAGGTTTCATTCCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020195.1-281s1c1
Sequence:CCGGCCCAACTCCACGGGAATATAACTCGAGTTATATTCCCGTGGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020195.1-1162s1c1
Sequence:CCGGGCTGCCTTAAAGGAAATTGTACTCGAGTACAATTTCCTTTAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-512s1c1
Sequence:CCGGGATGGAATGAAACCTTCCAAACTCGAGTTTGGAAGGTTTCATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-507s1c1
Sequence:CCGGCCGAAGATGGAATGAAACCTTCTCGAGAAGGTTTCATTCCATCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-618s1c1
Sequence:CCGGCTTAGTCACAGGTGTAGCTTACTCGAGTAAGCTACACCTGTGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020195.1-564s1c1
Sequence:CCGGCCAATTGCTGGCTAAAGCCATCTCGAGATGGCTTTAGCCAGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-1271s1c1
Sequence:CCGGGCTGAAGCCATCTGGTTCTTACTCGAGTAAGAACCAGATGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-624s1c1
Sequence:CCGGCACAGGTGTAGCTTACTACCACTCGAGTGGTAGTAAGCTACACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-1138s1c1
Sequence:CCGGCAGTATTCCTTCCCAGAGCTACTCGAGTAGCTCTGGGAAGGAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020195
VALIDATED
SDR39U1 MISSION shRNA Lentiviral Transduction Particles
short chain dehydrogenase/reductase family 39U, member 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-344s21c1
Sequence:CCGGCTTAGTCACAGGTGTAGCTTACTCGAGTAAGCTACACCTGTGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-864s21c1
Sequence:CCGGCAGTATTCCTTCCCAGAGCTACTCGAGTAGCTCTGGGAAGGAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020195.2-997s21c1
Sequence:CCGGGCTGAAGCCATCTGGTTCTTACTCGAGTAAGAACCAGATGGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020195.2-233s21c1
Sequence:CCGGCCGAAGATGGAATGAAACCTTCTCGAGAAGGTTTCATTCCATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020195.1-281s1c1
Sequence:CCGGCCCAACTCCACGGGAATATAACTCGAGTTATATTCCCGTGGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020195.1-1162s1c1
Sequence:CCGGGCTGCCTTAAAGGAAATTGTACTCGAGTACAATTTCCTTTAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-512s1c1
Sequence:CCGGGATGGAATGAAACCTTCCAAACTCGAGTTTGGAAGGTTTCATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-507s1c1
Sequence:CCGGCCGAAGATGGAATGAAACCTTCTCGAGAAGGTTTCATTCCATCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-618s1c1
Sequence:CCGGCTTAGTCACAGGTGTAGCTTACTCGAGTAAGCTACACCTGTGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020195.1-564s1c1
Sequence:CCGGCCAATTGCTGGCTAAAGCCATCTCGAGATGGCTTTAGCCAGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020195.1-1271s1c1
Sequence:CCGGGCTGAAGCCATCTGGTTCTTACTCGAGTAAGAACCAGATGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-624s1c1
Sequence:CCGGCACAGGTGTAGCTTACTACCACTCGAGTGGTAGTAAGCTACACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020195.1-1138s1c1
Sequence:CCGGCAGTATTCCTTCCCAGAGCTACTCGAGTAGCTCTGGGAAGGAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082975
SDR39U1 MISSION shRNA Bacterial Glycerol Stock
short chain dehydrogenase/reductase family 39U, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-573s21c1
Sequence:CCGGCATCGGTTCAGGTCGCCAATTCTCGAGAATTGGCGACCTGAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082975.1-1000s21c1
Sequence:CCGGAGAATCCATCAGGGTCTTAGACTCGAGTCTAAGACCCTGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-656s21c1
Sequence:CCGGACGTCCAAGGAGTCCTGAATGCTCGAGCATTCAGGACTCCTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-361s21c1
Sequence:CCGGTACCAGCCAAGCCTGACTAAGCTCGAGCTTAGTCAGGCTTGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-225s21c1
Sequence:CCGGTCTGCGAAGATGGAATGAAACCTCGAGGTTTCATTCCATCTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082975
SDR39U1 MISSION shRNA shRNA Plasmid DNA
short chain dehydrogenase/reductase family 39U, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-573s21c1
Sequence:CCGGCATCGGTTCAGGTCGCCAATTCTCGAGAATTGGCGACCTGAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082975.1-1000s21c1
Sequence:CCGGAGAATCCATCAGGGTCTTAGACTCGAGTCTAAGACCCTGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-656s21c1
Sequence:CCGGACGTCCAAGGAGTCCTGAATGCTCGAGCATTCAGGACTCCTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-361s21c1
Sequence:CCGGTACCAGCCAAGCCTGACTAAGCTCGAGCTTAGTCAGGCTTGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-225s21c1
Sequence:CCGGTCTGCGAAGATGGAATGAAACCTCGAGGTTTCATTCCATCTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082975
SDR39U1 MISSION shRNA Lentiviral Transduction Particles
short chain dehydrogenase/reductase family 39U, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-573s21c1
Sequence:CCGGCATCGGTTCAGGTCGCCAATTCTCGAGAATTGGCGACCTGAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082975.1-1000s21c1
Sequence:CCGGAGAATCCATCAGGGTCTTAGACTCGAGTCTAAGACCCTGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-656s21c1
Sequence:CCGGACGTCCAAGGAGTCCTGAATGCTCGAGCATTCAGGACTCCTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-361s21c1
Sequence:CCGGTACCAGCCAAGCCTGACTAAGCTCGAGCTTAGTCAGGCTTGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082975.1-225s21c1
Sequence:CCGGTCTGCGAAGATGGAATGAAACCTCGAGGTTTCATTCCATCTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks