EMAIL THIS PAGE TO A FRIEND

SDS

serine dehydratase

Synonyms: SDH
UniProtKB ID: P20132, A8K9P5
Gene ID:
Human(10993) Summary: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver. [provided by RefSeq, Jul 2008]
Mouse(231691) serine dehydratase
Rat(25044) serine dehydratase
Thale Cress(838040) cyclin-SDS
domestic cat(101086928) serine dehydratase
dog(486281) serine dehydratase
cow(514346) serine dehydratase
sheep(101112348) serine dehydratase
naked mole-rat(101722640) serine dehydratase
domestic guinea pig(100718435) serine dehydratase
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006843 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006843 Rosetta Predictions human pricing
NM_053962 Rosetta Predictions rat pricing
NM_145565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227229 predicted 436
2 SASI_Hs02_00342427 predicted 680
3 SASI_Hs02_00342428 predicted 550
4 SASI_Hs01_00227230 predicted 400
5 SASI_Hs01_00227232 predicted 403
6 SASI_Hs01_00227233 predicted 1351
7 SASI_Hs01_00227234 predicted 1332
8 SASI_Hs01_00227235 predicted 1069
9 SASI_Hs01_00227236 predicted 247
10 SASI_Hs01_00227237 predicted 383
11 SASI_Hs01_00227231 predicted 275
12 SASI_Hs01_00227238 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075244 predicted 260
2 SASI_Rn01_00075245 predicted 881
3 SASI_Rn01_00075246 predicted 371
4 SASI_Rn01_00075248 predicted 537
5 SASI_Rn01_00075249 predicted 819
6 SASI_Rn01_00075250 predicted 200
7 SASI_Rn02_00266934 predicted 457
8 SASI_Rn01_00075252 predicted 399
9 SASI_Rn02_00266935 predicted 202
10 SASI_Rn02_00266936 predicted 403
11 SASI_Rn01_00075247 predicted 253
12 SASI_Rn01_00075251 predicted 391
13 SASI_Rn01_00075253 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042245 predicted 475
2 SASI_Mm01_00042246 predicted 484
3 SASI_Mm02_00341071 predicted 335
4 SASI_Mm01_00042248 predicted 908
5 SASI_Mm02_00341072 predicted 337
6 SASI_Mm02_00341073 predicted 350
7 SASI_Mm01_00042249 predicted 290
8 SASI_Mm01_00042251 predicted 802
9 SASI_Mm01_00042253 predicted 464
10 SASI_Mm02_00341074 predicted 386
11 SASI_Mm01_00042247 predicted 297
12 SASI_Mm01_00042250 predicted 297
13 SASI_Mm01_00042252 predicted 649
14 SASI_Mm01_00042254 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145565
SDS MISSION shRNA Bacterial Glycerol Stock
serine dehydratase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-816s1c1
Sequence:CCGGCTTGAGAAGTTCGTGGACGATCTCGAGATCGTCCACGAACTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-332s1c1
Sequence:CCGGCCTCACCATTGAGCGGCTCAACTCGAGTTGAGCCGCTCAATGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-185s1c1
Sequence:CCGGCATTGGGCATCTCTGCAAGATCTCGAGATCTTGCAGAGATGCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-605s1c1
Sequence:CCGGCTGGGAGGATGTGCCCATCATCTCGAGATGATGGGCACATCCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-233s1c1
Sequence:CCGGTGTCTGTTCTTCAGCTGGCAACTCGAGTTGCCAGCTGAAGAACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145565.1-99s21c1
Sequence:CCGGAGCATGGCGTTGTCCAAATTGCTCGAGCAATTTGGACAACGCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145565.1-484s21c1
Sequence:CCGGGCCACACTTCCCTTGTGAAAGCTCGAGCTTTCACAAGGGAAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145565
SDS MISSION shRNA shRNA Plasmid DNA
serine dehydratase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-816s1c1
Sequence:CCGGCTTGAGAAGTTCGTGGACGATCTCGAGATCGTCCACGAACTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-332s1c1
Sequence:CCGGCCTCACCATTGAGCGGCTCAACTCGAGTTGAGCCGCTCAATGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-185s1c1
Sequence:CCGGCATTGGGCATCTCTGCAAGATCTCGAGATCTTGCAGAGATGCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-605s1c1
Sequence:CCGGCTGGGAGGATGTGCCCATCATCTCGAGATGATGGGCACATCCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-233s1c1
Sequence:CCGGTGTCTGTTCTTCAGCTGGCAACTCGAGTTGCCAGCTGAAGAACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145565.1-99s21c1
Sequence:CCGGAGCATGGCGTTGTCCAAATTGCTCGAGCAATTTGGACAACGCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145565.1-484s21c1
Sequence:CCGGGCCACACTTCCCTTGTGAAAGCTCGAGCTTTCACAAGGGAAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145565
SDS MISSION shRNA Lentiviral Transduction Particles
serine dehydratase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-816s1c1
Sequence:CCGGCTTGAGAAGTTCGTGGACGATCTCGAGATCGTCCACGAACTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-332s1c1
Sequence:CCGGCCTCACCATTGAGCGGCTCAACTCGAGTTGAGCCGCTCAATGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-185s1c1
Sequence:CCGGCATTGGGCATCTCTGCAAGATCTCGAGATCTTGCAGAGATGCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-605s1c1
Sequence:CCGGCTGGGAGGATGTGCCCATCATCTCGAGATGATGGGCACATCCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145565.1-233s1c1
Sequence:CCGGTGTCTGTTCTTCAGCTGGCAACTCGAGTTGCCAGCTGAAGAACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145565.1-99s21c1
Sequence:CCGGAGCATGGCGTTGTCCAAATTGCTCGAGCAATTTGGACAACGCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145565.1-484s21c1
Sequence:CCGGGCCACACTTCCCTTGTGAAAGCTCGAGCTTTCACAAGGGAAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006843
SDS MISSION shRNA Bacterial Glycerol Stock
serine dehydratase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-882s1c1
Sequence:CCGGGCCATTGAGAAGTTCGTGGATCTCGAGATCCACGAACTTCTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-452s1c1
Sequence:CCGGTGAGTTATTGGATGAAGCCTTCTCGAGAAGGCTTCATCCAATAACTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006843.2-1279s1c1
Sequence:CCGGCGAGGCTATGAATTGGACCTTCTCGAGAAGGTCCAATTCATAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-1079s1c1
Sequence:CCGGGCTGGGCATGACAAATAGGTTCTCGAGAACCTATTTGTCATGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-947s1c1
Sequence:CCGGCGCTGTCTATAGCCACGTGATCTCGAGATCACGTGGCTATAGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-848s21c1
Sequence:CCGGCTCTGAAGTTATCTCGGACCACTCGAGTGGTCCGAGATAACTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-281s21c1
Sequence:CCGGCAAGCAAGGCTGTGCACATTTCTCGAGAAATGTGCACAGCCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-812s21c1
Sequence:CCGGTCAGGCCCTGAAGCTGTTTCACTCGAGTGAAACAGCTTCAGGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-764s21c1
Sequence:CCGGCAAGATCACCAGTGTTGCCAACTCGAGTTGGCAACACTGGTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006843.2-1219s21c1
Sequence:CCGGTGCAGGTTAACTTCTTGTTATCTCGAGATAACAAGAAGTTAACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-554s21c1
Sequence:CCGGCCACGCTTCCATCGTGAAAGACTCGAGTCTTTCACGATGGAAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-737s21c1
Sequence:CCGGCACCGCAGGCAAACTTGTCTCCTCGAGGAGACAAGTTTGCCTGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-254s21c1
Sequence:CCGGCATTGGGCACTTCTGCAAGAGCTCGAGCTCTTGCAGAAGTGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006843
SDS MISSION shRNA shRNA Plasmid DNA
serine dehydratase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-882s1c1
Sequence:CCGGGCCATTGAGAAGTTCGTGGATCTCGAGATCCACGAACTTCTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-452s1c1
Sequence:CCGGTGAGTTATTGGATGAAGCCTTCTCGAGAAGGCTTCATCCAATAACTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006843.2-1279s1c1
Sequence:CCGGCGAGGCTATGAATTGGACCTTCTCGAGAAGGTCCAATTCATAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-1079s1c1
Sequence:CCGGGCTGGGCATGACAAATAGGTTCTCGAGAACCTATTTGTCATGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-947s1c1
Sequence:CCGGCGCTGTCTATAGCCACGTGATCTCGAGATCACGTGGCTATAGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-848s21c1
Sequence:CCGGCTCTGAAGTTATCTCGGACCACTCGAGTGGTCCGAGATAACTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-281s21c1
Sequence:CCGGCAAGCAAGGCTGTGCACATTTCTCGAGAAATGTGCACAGCCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-812s21c1
Sequence:CCGGTCAGGCCCTGAAGCTGTTTCACTCGAGTGAAACAGCTTCAGGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-764s21c1
Sequence:CCGGCAAGATCACCAGTGTTGCCAACTCGAGTTGGCAACACTGGTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006843.2-1219s21c1
Sequence:CCGGTGCAGGTTAACTTCTTGTTATCTCGAGATAACAAGAAGTTAACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-554s21c1
Sequence:CCGGCCACGCTTCCATCGTGAAAGACTCGAGTCTTTCACGATGGAAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-737s21c1
Sequence:CCGGCACCGCAGGCAAACTTGTCTCCTCGAGGAGACAAGTTTGCCTGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-254s21c1
Sequence:CCGGCATTGGGCACTTCTGCAAGAGCTCGAGCTCTTGCAGAAGTGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006843
SDS MISSION shRNA Lentiviral Transduction Particles
serine dehydratase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-882s1c1
Sequence:CCGGGCCATTGAGAAGTTCGTGGATCTCGAGATCCACGAACTTCTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-452s1c1
Sequence:CCGGTGAGTTATTGGATGAAGCCTTCTCGAGAAGGCTTCATCCAATAACTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006843.2-1279s1c1
Sequence:CCGGCGAGGCTATGAATTGGACCTTCTCGAGAAGGTCCAATTCATAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-1079s1c1
Sequence:CCGGGCTGGGCATGACAAATAGGTTCTCGAGAACCTATTTGTCATGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006843.2-947s1c1
Sequence:CCGGCGCTGTCTATAGCCACGTGATCTCGAGATCACGTGGCTATAGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-848s21c1
Sequence:CCGGCTCTGAAGTTATCTCGGACCACTCGAGTGGTCCGAGATAACTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-281s21c1
Sequence:CCGGCAAGCAAGGCTGTGCACATTTCTCGAGAAATGTGCACAGCCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-812s21c1
Sequence:CCGGTCAGGCCCTGAAGCTGTTTCACTCGAGTGAAACAGCTTCAGGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-764s21c1
Sequence:CCGGCAAGATCACCAGTGTTGCCAACTCGAGTTGGCAACACTGGTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006843.2-1219s21c1
Sequence:CCGGTGCAGGTTAACTTCTTGTTATCTCGAGATAACAAGAAGTTAACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-554s21c1
Sequence:CCGGCCACGCTTCCATCGTGAAAGACTCGAGTCTTTCACGATGGAAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-737s21c1
Sequence:CCGGCACCGCAGGCAAACTTGTCTCCTCGAGGAGACAAGTTTGCCTGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006843.2-254s21c1
Sequence:CCGGCATTGGGCACTTCTGCAAGAGCTCGAGCTCTTGCAGAAGTGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks