EMAIL THIS PAGE TO A FRIEND

SEC13

SEC13 homolog (S. cerevisiae)

Synonyms: D3S1231E SEC13L1 SEC13R npp-20
UniProtKB ID: P55735, A8MV37, Q5BJF0, Q9BRM6, Q9BUG7
Gene ID:
Human(6396) Summary: The protein encoded by this gene belongs to the SEC13 family of WD-repeat proteins. It is a constituent of the endoplasmic reticulum and the nuclear pore complex. It has similarity to the yeast SEC13 protein, which is required for vesicle biogenesis from endoplasmic reticulum during the transport of proteins. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2008]
Mouse(110379) SEC13 homolog (S. cerevisiae)
Rat(297522) SEC13 homolog (S. cerevisiae)
cow(512530) SEC13 homolog (S. cerevisiae)
sheep(101120784) SEC13 homolog (S. cerevisiae)
domestic guinea pig(100716969) SEC13 homolog (S. cerevisiae)
naked mole-rat(101709886) SEC13 homolog (S. cerevisiae)
fruit fly(44437) CG6773 gene product from transcript CG6773-RA
Zebrafish(798071) SEC13 homolog (S. cerevisiae)
domestic cat(101087389) SEC13 homolog (S. cerevisiae)
dog(607653) SEC13 homolog (S. cerevisiae)
chicken(416119) SEC13 homolog (S. cerevisiae)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030673 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_183352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183352 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030673 Rosetta Predictions human pricing
NM_183352 Rosetta Predictions human pricing
NM_001006978 Rosetta Predictions rat pricing
NM_024206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045682 predicted 986
2 SASI_Hs01_00045683 predicted 890
3 SASI_Hs01_00045684 predicted 877
4 SASI_Hs01_00045685 predicted 452
5 SASI_Hs01_00045686 predicted 561
6 SASI_Hs01_00045687 predicted 784
7 SASI_Hs01_00045688 predicted 577
8 SASI_Hs01_00045689 predicted 1046
9 SASI_Hs01_00045690 predicted 406
10 SASI_Hs01_00045691 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082244 predicted 950
2 SASI_Hs01_00082245 predicted 849
3 SASI_Hs01_00082248 predicted 522
4 SASI_Hs01_00082249 predicted 748
5 SASI_Hs02_00371262 predicted 942
6 SASI_Hs01_00082250 predicted 528
7 SASI_Hs01_00082251 predicted 1010
8 SASI_Hs01_00082253 predicted 560
9 SASI_Hs02_00371263 predicted 545
10 SASI_Hs02_00371264 predicted 880
11 SASI_Hs01_00082246 predicted 845
12 SASI_Hs01_00082247 predicted 423
13 SASI_Hs01_00082252 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120185 predicted 331
2 SASI_Rn01_00120186 predicted 777
3 SASI_Rn01_00120188 predicted 262
4 SASI_Rn01_00120189 predicted 259
5 SASI_Rn01_00120190 predicted 273
6 SASI_Rn01_00120191 predicted 772
7 SASI_Rn01_00120192 predicted 546
8 SASI_Rn01_00120193 predicted 587
9 SASI_Rn02_00198545 predicted 1013
10 SASI_Rn01_00120194 predicted 447
11 SASI_Rn01_00120187 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187896 predicted 733
2 SASI_Mm01_00187898 predicted 862
3 SASI_Mm01_00187899 predicted 332
4 SASI_Mm01_00187900 predicted 537
5 SASI_Mm01_00187901 predicted 769
6 SASI_Mm01_00187902 predicted 263
7 SASI_Mm01_00187903 predicted 897
8 SASI_Mm01_00187905 predicted 737
9 SASI_Mm02_00327562 predicted 761
10 SASI_Mm02_00327563 predicted 336
11 SASI_Mm01_00187897 predicted 989
12 SASI_Mm01_00187904 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030673
VALIDATED
SEC13 MISSION shRNA Bacterial Glycerol Stock
SEC13 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-400s1c1
Sequence:CCGGGTCATTATCTGGAGAGAGGAACTCGAGTTCCTCTCTCCAGATAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030673.2-679s1c1
Sequence:CCGGCCCAATTACATCAAGAGGTTTCTCGAGAAACCTCTTGATGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030673.2-181s1c1
Sequence:CCGGACCTCCCATGAGGACATGATTCTCGAGAATCATGTCCTCATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-871s1c1
Sequence:CCGGGTGTTCATTTGGACCTGTGATCTCGAGATCACAGGTCCAAATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-915s1c1
Sequence:CCGGCCCTAAATTGTTGCACAAGTTCTCGAGAACTTGTGCAACAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030673
VALIDATED
SEC13 MISSION shRNA shRNA Plasmid DNA
SEC13 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-400s1c1
Sequence:CCGGGTCATTATCTGGAGAGAGGAACTCGAGTTCCTCTCTCCAGATAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030673.2-679s1c1
Sequence:CCGGCCCAATTACATCAAGAGGTTTCTCGAGAAACCTCTTGATGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030673.2-181s1c1
Sequence:CCGGACCTCCCATGAGGACATGATTCTCGAGAATCATGTCCTCATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-871s1c1
Sequence:CCGGGTGTTCATTTGGACCTGTGATCTCGAGATCACAGGTCCAAATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-915s1c1
Sequence:CCGGCCCTAAATTGTTGCACAAGTTCTCGAGAACTTGTGCAACAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030673
VALIDATED
SEC13 MISSION shRNA Lentiviral Transduction Particles
SEC13 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-400s1c1
Sequence:CCGGGTCATTATCTGGAGAGAGGAACTCGAGTTCCTCTCTCCAGATAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030673.2-679s1c1
Sequence:CCGGCCCAATTACATCAAGAGGTTTCTCGAGAAACCTCTTGATGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030673.2-181s1c1
Sequence:CCGGACCTCCCATGAGGACATGATTCTCGAGAATCATGTCCTCATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-871s1c1
Sequence:CCGGGTGTTCATTTGGACCTGTGATCTCGAGATCACAGGTCCAAATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_030673.2-915s1c1
Sequence:CCGGCCCTAAATTGTTGCACAAGTTCTCGAGAACTTGTGCAACAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024206
VALIDATED
SEC13 MISSION shRNA Bacterial Glycerol Stock
SEC13 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-1048s1c1
Sequence:CCGGCCTCCAAACAACTGGGAAGAACTCGAGTTCTTCCCAGTTGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-807s1c1
Sequence:CCGGCTACACAAGTTCAATGATGTTCTCGAGAACATCATTGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024206.3-529s1c1
Sequence:CCGGGAAGCCTTATAGACCAACCATCTCGAGATGGTTGGTCTATAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024206.3-275s1c1
Sequence:CCGGCCGGAAAGTCATCATCTGGAACTCGAGTTCCAGATGATGACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-477s1c1
Sequence:CCGGGCTCACACGATTGGCTGTAATCTCGAGATTACAGCCAATCGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-418s21c1
Sequence:GTACCGGCATCTCACTGCTGACCTATACCTCGAGGTATAGGTCAGCAGTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-769s21c1
Sequence:GTACCGGTGACGATGCCTCAGGCAATATCTCGAGATATTGCCTGAGGCATCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024206.4-1047s21c1
Sequence:CCGGCCTCCAAACAACTGGGAAGAACTCGAGTTCTTCCCAGTTGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-476s21c1
Sequence:CCGGGCTCACACGATTGGCTGTAATCTCGAGATTACAGCCAATCGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-806s21c1
Sequence:CCGGCTACACAAGTTCAATGATGTTCTCGAGAACATCATTGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-274s21c1
Sequence:CCGGCCGGAAAGTCATCATCTGGAACTCGAGTTCCAGATGATGACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-738s21c1
Sequence:GTACCGGCTCAGGATGGTCGAGTGTTTACTCGAGTAAACACTCGACCATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024206
VALIDATED
SEC13 MISSION shRNA shRNA Plasmid DNA
SEC13 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-1048s1c1
Sequence:CCGGCCTCCAAACAACTGGGAAGAACTCGAGTTCTTCCCAGTTGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-807s1c1
Sequence:CCGGCTACACAAGTTCAATGATGTTCTCGAGAACATCATTGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024206.3-529s1c1
Sequence:CCGGGAAGCCTTATAGACCAACCATCTCGAGATGGTTGGTCTATAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024206.3-275s1c1
Sequence:CCGGCCGGAAAGTCATCATCTGGAACTCGAGTTCCAGATGATGACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-477s1c1
Sequence:CCGGGCTCACACGATTGGCTGTAATCTCGAGATTACAGCCAATCGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-418s21c1
Sequence:GTACCGGCATCTCACTGCTGACCTATACCTCGAGGTATAGGTCAGCAGTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-769s21c1
Sequence:GTACCGGTGACGATGCCTCAGGCAATATCTCGAGATATTGCCTGAGGCATCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024206.4-1047s21c1
Sequence:CCGGCCTCCAAACAACTGGGAAGAACTCGAGTTCTTCCCAGTTGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-476s21c1
Sequence:CCGGGCTCACACGATTGGCTGTAATCTCGAGATTACAGCCAATCGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-806s21c1
Sequence:CCGGCTACACAAGTTCAATGATGTTCTCGAGAACATCATTGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-274s21c1
Sequence:CCGGCCGGAAAGTCATCATCTGGAACTCGAGTTCCAGATGATGACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-738s21c1
Sequence:GTACCGGCTCAGGATGGTCGAGTGTTTACTCGAGTAAACACTCGACCATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024206
VALIDATED
SEC13 MISSION shRNA Lentiviral Transduction Particles
SEC13 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-1048s1c1
Sequence:CCGGCCTCCAAACAACTGGGAAGAACTCGAGTTCTTCCCAGTTGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-807s1c1
Sequence:CCGGCTACACAAGTTCAATGATGTTCTCGAGAACATCATTGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024206.3-529s1c1
Sequence:CCGGGAAGCCTTATAGACCAACCATCTCGAGATGGTTGGTCTATAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024206.3-275s1c1
Sequence:CCGGCCGGAAAGTCATCATCTGGAACTCGAGTTCCAGATGATGACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024206.3-477s1c1
Sequence:CCGGGCTCACACGATTGGCTGTAATCTCGAGATTACAGCCAATCGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-418s21c1
Sequence:GTACCGGCATCTCACTGCTGACCTATACCTCGAGGTATAGGTCAGCAGTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-769s21c1
Sequence:GTACCGGTGACGATGCCTCAGGCAATATCTCGAGATATTGCCTGAGGCATCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024206.4-1047s21c1
Sequence:CCGGCCTCCAAACAACTGGGAAGAACTCGAGTTCTTCCCAGTTGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-476s21c1
Sequence:CCGGGCTCACACGATTGGCTGTAATCTCGAGATTACAGCCAATCGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-806s21c1
Sequence:CCGGCTACACAAGTTCAATGATGTTCTCGAGAACATCATTGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-274s21c1
Sequence:CCGGCCGGAAAGTCATCATCTGGAACTCGAGTTCCAGATGATGACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024206.4-738s21c1
Sequence:GTACCGGCTCAGGATGGTCGAGTGTTTACTCGAGTAAACACTCGACCATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183352
VALIDATED
SEC13 MISSION shRNA Bacterial Glycerol Stock
SEC13 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-366s21c1
Sequence:CCGGGTCATTATCTGGAGAGAGGAACTCGAGTTCCTCTCTCCAGATAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183352.1-1224s21c1
Sequence:GTACCGGAGATTGATCATCTGCCTTAACCTCGAGGTTAAGGCAGATGATCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-826s21c1
Sequence:GTACCGGAGGATGGTCGTGTGTTCATTTCTCGAGAAATGAACACACGACCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-854s21c1
Sequence:GTACCGGTGATGATGCCTCAAGCAATACCTCGAGGTATTGCTTGAGGCATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-248s21c1
Sequence:CCGGCAATGGAGGGCAGATCCTTATCTCGAGATAAGGATCTGCCCTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183352.1-1174s21c1
Sequence:CCGGCCCAACTCCAACAGGATTATTCTCGAGAATAATCCTGTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-172s21c1
Sequence:CCGGACGCCCAGATGGACTACTATGCTCGAGCATAGTAGTCCATCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-881s21c1
Sequence:CCGGCCCTAAATTGTTGCACAAGTTCTCGAGAACTTGTGCAACAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-213s21c1
Sequence:GTACCGGTCATCAGACAGGTCCGTCAAACTCGAGTTTGACGGACCTGTCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183352
VALIDATED
SEC13 MISSION shRNA shRNA Plasmid DNA
SEC13 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-366s21c1
Sequence:CCGGGTCATTATCTGGAGAGAGGAACTCGAGTTCCTCTCTCCAGATAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183352.1-1224s21c1
Sequence:GTACCGGAGATTGATCATCTGCCTTAACCTCGAGGTTAAGGCAGATGATCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-826s21c1
Sequence:GTACCGGAGGATGGTCGTGTGTTCATTTCTCGAGAAATGAACACACGACCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-854s21c1
Sequence:GTACCGGTGATGATGCCTCAAGCAATACCTCGAGGTATTGCTTGAGGCATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-248s21c1
Sequence:CCGGCAATGGAGGGCAGATCCTTATCTCGAGATAAGGATCTGCCCTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183352.1-1174s21c1
Sequence:CCGGCCCAACTCCAACAGGATTATTCTCGAGAATAATCCTGTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-172s21c1
Sequence:CCGGACGCCCAGATGGACTACTATGCTCGAGCATAGTAGTCCATCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-881s21c1
Sequence:CCGGCCCTAAATTGTTGCACAAGTTCTCGAGAACTTGTGCAACAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-213s21c1
Sequence:GTACCGGTCATCAGACAGGTCCGTCAAACTCGAGTTTGACGGACCTGTCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183352
VALIDATED
SEC13 MISSION shRNA Lentiviral Transduction Particles
SEC13 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-366s21c1
Sequence:CCGGGTCATTATCTGGAGAGAGGAACTCGAGTTCCTCTCTCCAGATAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183352.1-1224s21c1
Sequence:GTACCGGAGATTGATCATCTGCCTTAACCTCGAGGTTAAGGCAGATGATCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-826s21c1
Sequence:GTACCGGAGGATGGTCGTGTGTTCATTTCTCGAGAAATGAACACACGACCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-854s21c1
Sequence:GTACCGGTGATGATGCCTCAAGCAATACCTCGAGGTATTGCTTGAGGCATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-248s21c1
Sequence:CCGGCAATGGAGGGCAGATCCTTATCTCGAGATAAGGATCTGCCCTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183352.1-1174s21c1
Sequence:CCGGCCCAACTCCAACAGGATTATTCTCGAGAATAATCCTGTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-172s21c1
Sequence:CCGGACGCCCAGATGGACTACTATGCTCGAGCATAGTAGTCCATCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_183352.1-881s21c1
Sequence:CCGGCCCTAAATTGTTGCACAAGTTCTCGAGAACTTGTGCAACAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183352.1-213s21c1
Sequence:GTACCGGTCATCAGACAGGTCCGTCAAACTCGAGTTTGACGGACCTGTCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks