EMAIL THIS PAGE TO A FRIEND

SEC16B

SEC16 homolog B (S. cerevisiae)

Synonyms: LZTR2 PGPR-p117 RGPR SEC16S
UniProtKB ID: Q96JE7, A3EYF1, Q5HYF6, Q8N7D6, Q96GX6
Gene ID:
Human(89866) Summary: SEC16B is a mammalian homolog of S. cerevisiae Sec16 that is required for organization of transitional endoplasmic reticulum (ER) sites and protein export (Bhattacharyya and Glick, 2007 [PubMed 17192411]
Mouse(89867) SEC16 homolog B (S. cerevisiae)
Rat(89868) SEC16 homolog B (S. cerevisiae)
cow(404548) SEC16 homolog B (S. cerevisiae)
sheep(101118120) SEC16 homolog B (S. cerevisiae)
naked mole-rat(101713248) SEC16 homolog B (S. cerevisiae)
Domestic Rabbit(100008637) SEC16 homolog B (S. cerevisiae)
domestic guinea pig(100727795) SEC16 homolog B (S. cerevisiae)
chicken(424431) SEC16 homolog B (S. cerevisiae)
domestic cat(101099013) SEC16 homolog B (S. cerevisiae)
Horse(100052827) SEC16 homolog B (S. cerevisiae)
dog(490329) SEC16 homolog B (S. cerevisiae)
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033127 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033127 Rosetta Predictions human pricing
NM_053571 Rosetta Predictions rat pricing
NM_033354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246264 predicted 725
2 SASI_Hs01_00246265 predicted 1712
3 SASI_Hs01_00246266 predicted 509
4 SASI_Hs02_00360855 predicted 436
5 SASI_Hs01_00246268 predicted 909
6 SASI_Hs01_00246270 predicted 1675
7 SASI_Hs01_00246271 predicted 408
8 SASI_Hs01_00246272 predicted 440
9 SASI_Hs01_00246273 predicted 2799
10 SASI_Hs02_00360856 predicted 734
11 SASI_Hs01_00246267 predicted 3372
12 SASI_Hs01_00246269 predicted 2486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080721 predicted 792
2 SASI_Rn01_00080722 predicted 220
3 SASI_Rn02_00266233 predicted 647
4 SASI_Rn01_00080725 predicted 612
5 SASI_Rn01_00080726 predicted 2038
6 SASI_Rn01_00080727 predicted 1909
7 SASI_Rn01_00080728 predicted 986
8 SASI_Rn01_00080729 predicted 1721
9 SASI_Rn01_00080730 predicted 447
10 SASI_Rn02_00266234 predicted 2600
11 SASI_Rn01_00080723 predicted 1699
12 SASI_Rn01_00080724 predicted 3187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178925 predicted 2412
2 SASI_Mm01_00178926 predicted 430
3 SASI_Mm01_00178928 predicted 2937
4 SASI_Mm01_00178929 predicted 1038
5 SASI_Mm01_00178930 predicted 1864
6 SASI_Mm01_00178931 predicted 1959
7 SASI_Mm01_00178932 predicted 1769
8 SASI_Mm01_00178933 predicted 217
9 SASI_Mm02_00337341 predicted 624
10 SASI_Mm01_00178934 predicted 703
11 SASI_Mm01_00178927 predicted 3218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033354
SEC16B MISSION shRNA Bacterial Glycerol Stock
SEC16 homolog B (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033354.2-3768s1c1
Sequence:CCGGCCCTCCTTAGACTTGCTTAAACTCGAGTTTAAGCAAGTCTAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-221s1c1
Sequence:CCGGGACCATCAAGGGATACAAATACTCGAGTATTTGTATCCCTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-1926s1c1
Sequence:CCGGCCACAGTCAAGAGTTTATGAACTCGAGTTCATAAACTCTTGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-1753s1c1
Sequence:CCGGCTGTCAAATCAGGCTGGAGATCTCGAGATCTCCAGCCTGATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-687s1c1
Sequence:CCGGCCAGTTCCAATTTACCAGTAACTCGAGTTACTGGTAAATTGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033354.2-4277s1c1
Sequence:CCGGGCTGTTTGTCAGATTTGCTTACTCGAGTAAGCAAATCTGACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-221s21c1
Sequence:CCGGGACCATCAAGGGATACAAATACTCGAGTATTTGTATCCCTTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-687s21c1
Sequence:CCGGCCAGTTCCAATTTACCAGTAACTCGAGTTACTGGTAAATTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033354.2-2323s1c1
Sequence:CCGGGATTCGACTCCTTCAGATATTCTCGAGAATATCTGAAGGAGTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033354.2-421s1c1
Sequence:CCGGGACTACTTGAAAGGATCTTATCTCGAGATAAGATCCTTTCAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-1926s21c1
Sequence:CCGGCCACAGTCAAGAGTTTATGAACTCGAGTTCATAAACTCTTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-1753s21c1
Sequence:CCGGCTGTCAAATCAGGCTGGAGATCTCGAGATCTCCAGCCTGATTTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033354
SEC16B MISSION shRNA shRNA Plasmid DNA
SEC16 homolog B (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033354.2-3768s1c1
Sequence:CCGGCCCTCCTTAGACTTGCTTAAACTCGAGTTTAAGCAAGTCTAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-221s1c1
Sequence:CCGGGACCATCAAGGGATACAAATACTCGAGTATTTGTATCCCTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-1926s1c1
Sequence:CCGGCCACAGTCAAGAGTTTATGAACTCGAGTTCATAAACTCTTGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-1753s1c1
Sequence:CCGGCTGTCAAATCAGGCTGGAGATCTCGAGATCTCCAGCCTGATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-687s1c1
Sequence:CCGGCCAGTTCCAATTTACCAGTAACTCGAGTTACTGGTAAATTGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033354.2-4277s1c1
Sequence:CCGGGCTGTTTGTCAGATTTGCTTACTCGAGTAAGCAAATCTGACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-221s21c1
Sequence:CCGGGACCATCAAGGGATACAAATACTCGAGTATTTGTATCCCTTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-687s21c1
Sequence:CCGGCCAGTTCCAATTTACCAGTAACTCGAGTTACTGGTAAATTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033354.2-2323s1c1
Sequence:CCGGGATTCGACTCCTTCAGATATTCTCGAGAATATCTGAAGGAGTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033354.2-421s1c1
Sequence:CCGGGACTACTTGAAAGGATCTTATCTCGAGATAAGATCCTTTCAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-1926s21c1
Sequence:CCGGCCACAGTCAAGAGTTTATGAACTCGAGTTCATAAACTCTTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-1753s21c1
Sequence:CCGGCTGTCAAATCAGGCTGGAGATCTCGAGATCTCCAGCCTGATTTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033354
SEC16B MISSION shRNA Lentiviral Transduction Particles
SEC16 homolog B (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033354.2-3768s1c1
Sequence:CCGGCCCTCCTTAGACTTGCTTAAACTCGAGTTTAAGCAAGTCTAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-221s1c1
Sequence:CCGGGACCATCAAGGGATACAAATACTCGAGTATTTGTATCCCTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-1926s1c1
Sequence:CCGGCCACAGTCAAGAGTTTATGAACTCGAGTTCATAAACTCTTGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-1753s1c1
Sequence:CCGGCTGTCAAATCAGGCTGGAGATCTCGAGATCTCCAGCCTGATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033354.2-687s1c1
Sequence:CCGGCCAGTTCCAATTTACCAGTAACTCGAGTTACTGGTAAATTGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033354.2-4277s1c1
Sequence:CCGGGCTGTTTGTCAGATTTGCTTACTCGAGTAAGCAAATCTGACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-221s21c1
Sequence:CCGGGACCATCAAGGGATACAAATACTCGAGTATTTGTATCCCTTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-687s21c1
Sequence:CCGGCCAGTTCCAATTTACCAGTAACTCGAGTTACTGGTAAATTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033354.2-2323s1c1
Sequence:CCGGGATTCGACTCCTTCAGATATTCTCGAGAATATCTGAAGGAGTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033354.2-421s1c1
Sequence:CCGGGACTACTTGAAAGGATCTTATCTCGAGATAAGATCCTTTCAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-1926s21c1
Sequence:CCGGCCACAGTCAAGAGTTTATGAACTCGAGTTCATAAACTCTTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033354.2-1753s21c1
Sequence:CCGGCTGTCAAATCAGGCTGGAGATCTCGAGATCTCCAGCCTGATTTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033127
SEC16B MISSION shRNA Bacterial Glycerol Stock
SEC16 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-220s1c1
Sequence:CCGGGAGAGGTTTCACCAATGGCAACTCGAGTTGCCATTGGTGAAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-1431s1c1
Sequence:CCGGGCTGCTCTACTATGGAAGGAACTCGAGTTCCTTCCATAGTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033127.1-3719s1c1
Sequence:CCGGGACCAATACATGGCTCTATTTCTCGAGAAATAGAGCCATGTATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-2671s1c1
Sequence:CCGGGCTGCTAGACCACGAAGTATTCTCGAGAATACTTCGTGGTCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-2681s1c1
Sequence:CCGGCACGAAGTATTTCTGAGAGTTCTCGAGAACTCTCAGAAATACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-1968s1c1
Sequence:CCGGCCAGGTGTATAAGCTCCTTTACTCGAGTAAAGGAGCTTATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-1969s1c1
Sequence:CCGGCAGGTGTATAAGCTCCTTTATCTCGAGATAAAGGAGCTTATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-614s1c1
Sequence:CCGGCCCACTTCCAATCTAACAGTACTCGAGTACTGTTAGATTGGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-1947s1c1
Sequence:CCGGCAAATCCTTCATCCCTTCTTTCTCGAGAAAGAAGGGATGAAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033127
SEC16B MISSION shRNA shRNA Plasmid DNA
SEC16 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-220s1c1
Sequence:CCGGGAGAGGTTTCACCAATGGCAACTCGAGTTGCCATTGGTGAAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-1431s1c1
Sequence:CCGGGCTGCTCTACTATGGAAGGAACTCGAGTTCCTTCCATAGTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033127.1-3719s1c1
Sequence:CCGGGACCAATACATGGCTCTATTTCTCGAGAAATAGAGCCATGTATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-2671s1c1
Sequence:CCGGGCTGCTAGACCACGAAGTATTCTCGAGAATACTTCGTGGTCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-2681s1c1
Sequence:CCGGCACGAAGTATTTCTGAGAGTTCTCGAGAACTCTCAGAAATACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-1968s1c1
Sequence:CCGGCCAGGTGTATAAGCTCCTTTACTCGAGTAAAGGAGCTTATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-1969s1c1
Sequence:CCGGCAGGTGTATAAGCTCCTTTATCTCGAGATAAAGGAGCTTATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-614s1c1
Sequence:CCGGCCCACTTCCAATCTAACAGTACTCGAGTACTGTTAGATTGGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-1947s1c1
Sequence:CCGGCAAATCCTTCATCCCTTCTTTCTCGAGAAAGAAGGGATGAAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033127
SEC16B MISSION shRNA Lentiviral Transduction Particles
SEC16 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-220s1c1
Sequence:CCGGGAGAGGTTTCACCAATGGCAACTCGAGTTGCCATTGGTGAAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-1431s1c1
Sequence:CCGGGCTGCTCTACTATGGAAGGAACTCGAGTTCCTTCCATAGTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033127.1-3719s1c1
Sequence:CCGGGACCAATACATGGCTCTATTTCTCGAGAAATAGAGCCATGTATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-2671s1c1
Sequence:CCGGGCTGCTAGACCACGAAGTATTCTCGAGAATACTTCGTGGTCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-2681s1c1
Sequence:CCGGCACGAAGTATTTCTGAGAGTTCTCGAGAACTCTCAGAAATACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-1968s1c1
Sequence:CCGGCCAGGTGTATAAGCTCCTTTACTCGAGTAAAGGAGCTTATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-1969s1c1
Sequence:CCGGCAGGTGTATAAGCTCCTTTATCTCGAGATAAAGGAGCTTATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033127.1-614s1c1
Sequence:CCGGCCCACTTCCAATCTAACAGTACTCGAGTACTGTTAGATTGGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033127.1-1947s1c1
Sequence:CCGGCAAATCCTTCATCCCTTCTTTCTCGAGAAAGAAGGGATGAAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks