EMAIL THIS PAGE TO A FRIEND

SEC63

SEC63 homolog (S. cerevisiae)

Synonyms: DNAJC23 ERdj2 PRO2507 SEC63L
UniProtKB ID: Q9UGP8, O95380, Q5THN4, Q86VS9, Q8IWL0, Q9NTE0
Gene ID:
Human(11231) Summary: The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
Mouse(140740) SEC63-like (S. cerevisiae)
Rat(309858) SEC63 homolog (S. cerevisiae)
fruit fly(38819) CG8583 gene product from transcript CG8583-RA
Horse(100072096) SEC63 homolog (S. cerevisiae)
domestic cat(101093937) SEC63 homolog (S. cerevisiae)
dog(475016) SEC63 homolog (S. cerevisiae)
chicken(421774) SEC63 homolog (S. cerevisiae)
Zebrafish(436861) SEC63-like (S. cerevisiae)
cow(541040) SEC63 homolog (S. cerevisiae)
sheep(101118280) SEC63 homolog (S. cerevisiae)
naked mole-rat(101701880) SEC63 homolog (S. cerevisiae)
Domestic Rabbit(100328696) SEC63 homolog (S. cerevisiae)
domestic guinea pig(100728680) SEC63 homolog (S. cerevisiae)
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007214 Rosetta Predictions human pricing
NM_001107637 Rosetta Predictions rat pricing
NM_153055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227470 predicted 1506
2 SASI_Hs02_00343205 predicted 884
3 SASI_Hs01_00227471 predicted 621
4 SASI_Hs01_00227472 predicted 307
5 SASI_Hs01_00227473 predicted 352
6 SASI_Hs01_00227477 predicted 1011
7 SASI_Hs02_00343206 predicted 558
8 SASI_Hs02_00343207 predicted 848
9 SASI_Hs02_00343208 predicted 341
10 SASI_Hs02_00343209 predicted 1272
11 SASI_Hs01_00227469 predicted 2125
12 SASI_Hs01_00227474 predicted 2060
13 SASI_Hs01_00227475 predicted 2320
14 SASI_Hs01_00227476 predicted 2185
15 SASI_Hs01_00227478 predicted 2252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230795 predicted 2133
2 SASI_Rn02_00230796 predicted 2127
3 SASI_Rn02_00230797 predicted 2212
4 SASI_Rn02_00230798 predicted 396
5 SASI_Rn02_00230799 predicted 1281
6 SASI_Rn02_00230800 predicted 541
7 SASI_Rn02_00230801 predicted 828
8 SASI_Rn02_00230802 predicted 953
9 SASI_Rn02_00230803 predicted 2404
10 SASI_Rn02_00230804 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040071 predicted 2267
2 SASI_Mm01_00040073 predicted 775
3 SASI_Mm01_00040074 predicted 1106
4 SASI_Mm01_00040075 predicted 972
5 SASI_Mm02_00342863 predicted 399
6 SASI_Mm01_00040076 predicted 435
7 SASI_Mm02_00342864 predicted 2366
8 SASI_Mm01_00040077 predicted 1320
9 SASI_Mm01_00040078 predicted 2329
10 SASI_Mm01_00040079 predicted 575
11 SASI_Mm01_00040072 predicted 1940
12 SASI_Mm01_00040080 predicted 1057
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153055
VALIDATED
SEC63 MISSION shRNA Bacterial Glycerol Stock
SEC63 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153055.2-1436s1c1
Sequence:CCGGCCCTAGTTACAGTGTTGGTTACTCGAGTAACCAACACTGTAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153055.2-1415s1c1
Sequence:CCGGGCAACAACATCACAGTAGGATCTCGAGATCCTACTGTGATGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153055.2-2160s1c1
Sequence:CCGGCCAGATTAAACCACTGAAGTTCTCGAGAACTTCAGTGGTTTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153055.2-1879s1c1
Sequence:CCGGCAAGAGTTACAACAGAGTATACTCGAGTATACTCTGTTGTAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153055.2-2068s1c1
Sequence:CCGGGAAGAGGTAGAACTGAAGTTTCTCGAGAAACTTCAGTTCTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-389s21c1
Sequence:CCGGCGCGGAGCAAATTCGATTAAACTCGAGTTTAATCGAATTTGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-1283s21c1
Sequence:CCGGTGTAATCTGCCAGCTAATAATCTCGAGATTATTAGCTGGCAGATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-897s21c1
Sequence:CCGGTCTTGGTGGTATCGGTCAATACTCGAGTATTGACCGATACCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-441s21c1
Sequence:CCGGTGGTATCGTTTACGGTTATTACTCGAGTAATAACCGTAAACGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153055.3-3728s1c1
Sequence:CCGGCACACGTCTACAGTACTATAACTCGAGTTATAGTACTGTAGACGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153055.3-2973s21c1
Sequence:CCGGCTGTTAGTAAGCTCTATTATTCTCGAGAATAATAGAGCTTACTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153055
VALIDATED
SEC63 MISSION shRNA shRNA Plasmid DNA
SEC63 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153055.2-1436s1c1
Sequence:CCGGCCCTAGTTACAGTGTTGGTTACTCGAGTAACCAACACTGTAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153055.2-1415s1c1
Sequence:CCGGGCAACAACATCACAGTAGGATCTCGAGATCCTACTGTGATGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153055.2-2160s1c1
Sequence:CCGGCCAGATTAAACCACTGAAGTTCTCGAGAACTTCAGTGGTTTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153055.2-1879s1c1
Sequence:CCGGCAAGAGTTACAACAGAGTATACTCGAGTATACTCTGTTGTAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153055.2-2068s1c1
Sequence:CCGGGAAGAGGTAGAACTGAAGTTTCTCGAGAAACTTCAGTTCTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-389s21c1
Sequence:CCGGCGCGGAGCAAATTCGATTAAACTCGAGTTTAATCGAATTTGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-1283s21c1
Sequence:CCGGTGTAATCTGCCAGCTAATAATCTCGAGATTATTAGCTGGCAGATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-897s21c1
Sequence:CCGGTCTTGGTGGTATCGGTCAATACTCGAGTATTGACCGATACCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-441s21c1
Sequence:CCGGTGGTATCGTTTACGGTTATTACTCGAGTAATAACCGTAAACGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153055.3-3728s1c1
Sequence:CCGGCACACGTCTACAGTACTATAACTCGAGTTATAGTACTGTAGACGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153055.3-2973s21c1
Sequence:CCGGCTGTTAGTAAGCTCTATTATTCTCGAGAATAATAGAGCTTACTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153055
VALIDATED
SEC63 MISSION shRNA Lentiviral Transduction Particles
SEC63 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153055.2-1436s1c1
Sequence:CCGGCCCTAGTTACAGTGTTGGTTACTCGAGTAACCAACACTGTAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153055.2-1415s1c1
Sequence:CCGGGCAACAACATCACAGTAGGATCTCGAGATCCTACTGTGATGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153055.2-2160s1c1
Sequence:CCGGCCAGATTAAACCACTGAAGTTCTCGAGAACTTCAGTGGTTTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153055.2-1879s1c1
Sequence:CCGGCAAGAGTTACAACAGAGTATACTCGAGTATACTCTGTTGTAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153055.2-2068s1c1
Sequence:CCGGGAAGAGGTAGAACTGAAGTTTCTCGAGAAACTTCAGTTCTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-389s21c1
Sequence:CCGGCGCGGAGCAAATTCGATTAAACTCGAGTTTAATCGAATTTGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-1283s21c1
Sequence:CCGGTGTAATCTGCCAGCTAATAATCTCGAGATTATTAGCTGGCAGATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-897s21c1
Sequence:CCGGTCTTGGTGGTATCGGTCAATACTCGAGTATTGACCGATACCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153055.3-441s21c1
Sequence:CCGGTGGTATCGTTTACGGTTATTACTCGAGTAATAACCGTAAACGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153055.3-3728s1c1
Sequence:CCGGCACACGTCTACAGTACTATAACTCGAGTTATAGTACTGTAGACGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153055.3-2973s21c1
Sequence:CCGGCTGTTAGTAAGCTCTATTATTCTCGAGAATAATAGAGCTTACTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007214
VALIDATED
SEC63 MISSION shRNA Bacterial Glycerol Stock
SEC63 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-254s1c1
Sequence:CCGGCCGAGCAAATTCGATTAAAGACTCGAGTCTTTAATCGAATTTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-2193s1c1
Sequence:CCGGCAAGCCTGGAAATTATCAGTACTCGAGTACTGATAATTTCCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-2263s1c1
Sequence:CCGGCCATTGAAGTTGGAAGTTCATCTCGAGATGAACTTCCAACTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1123s1c1
Sequence:CCGGGCCCTACTTCAAGAAATGGTTCTCGAGAACCATTTCTTGAAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-1560s1c1
Sequence:CCGGGCAAACAATGGCTGAAGTATTCTCGAGAATACTTCAGCCATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1082s1c1
Sequence:CCGGCCCTTGAAGAAGATCAGCAATCTCGAGATTGCTGATCTTCTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-303s1c1
Sequence:CCGGGTGGTATCGTTTACGGTTATTCTCGAGAATAACCGTAAACGATACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007214.2-2088s1c1
Sequence:CCGGGCTTTACATTGCAGATAGGAACTCGAGTTCCTATCTGCAATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-955s1c1
Sequence:CCGGCCACAGCTAATCAGAGAAATTCTCGAGAATTTCTCTGATTAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007214.2-2101s1c1
Sequence:CCGGGATAGGAAGGAGCAGACATTACTCGAGTAATGTCTGCTCCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1786s1c1
Sequence:CCGGGCAAATGGAGTCGTTGGGAATCTCGAGATTCCCAACGACTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1219s21c1
Sequence:CCGGCCCTTGAAGAAGATCAGCAATCTCGAGATTGCTGATCTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1923s21c1
Sequence:CCGGGCAAATGGAGTCGTTGGGAATCTCGAGATTCCCAACGACTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1260s21c1
Sequence:CCGGGCCCTACTTCAAGAAATGGTTCTCGAGAACCATTTCTTGAAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-440s21c1
Sequence:CCGGGTGGTATCGTTTACGGTTATTCTCGAGAATAACCGTAAACGATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-2400s21c1
Sequence:CCGGCCATTGAAGTTGGAAGTTCATCTCGAGATGAACTTCCAACTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007214
VALIDATED
SEC63 MISSION shRNA shRNA Plasmid DNA
SEC63 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-254s1c1
Sequence:CCGGCCGAGCAAATTCGATTAAAGACTCGAGTCTTTAATCGAATTTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-2193s1c1
Sequence:CCGGCAAGCCTGGAAATTATCAGTACTCGAGTACTGATAATTTCCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-2263s1c1
Sequence:CCGGCCATTGAAGTTGGAAGTTCATCTCGAGATGAACTTCCAACTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1123s1c1
Sequence:CCGGGCCCTACTTCAAGAAATGGTTCTCGAGAACCATTTCTTGAAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-1560s1c1
Sequence:CCGGGCAAACAATGGCTGAAGTATTCTCGAGAATACTTCAGCCATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1082s1c1
Sequence:CCGGCCCTTGAAGAAGATCAGCAATCTCGAGATTGCTGATCTTCTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-303s1c1
Sequence:CCGGGTGGTATCGTTTACGGTTATTCTCGAGAATAACCGTAAACGATACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007214.2-2088s1c1
Sequence:CCGGGCTTTACATTGCAGATAGGAACTCGAGTTCCTATCTGCAATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-955s1c1
Sequence:CCGGCCACAGCTAATCAGAGAAATTCTCGAGAATTTCTCTGATTAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007214.2-2101s1c1
Sequence:CCGGGATAGGAAGGAGCAGACATTACTCGAGTAATGTCTGCTCCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1786s1c1
Sequence:CCGGGCAAATGGAGTCGTTGGGAATCTCGAGATTCCCAACGACTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1219s21c1
Sequence:CCGGCCCTTGAAGAAGATCAGCAATCTCGAGATTGCTGATCTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1923s21c1
Sequence:CCGGGCAAATGGAGTCGTTGGGAATCTCGAGATTCCCAACGACTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1260s21c1
Sequence:CCGGGCCCTACTTCAAGAAATGGTTCTCGAGAACCATTTCTTGAAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-440s21c1
Sequence:CCGGGTGGTATCGTTTACGGTTATTCTCGAGAATAACCGTAAACGATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-2400s21c1
Sequence:CCGGCCATTGAAGTTGGAAGTTCATCTCGAGATGAACTTCCAACTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007214
VALIDATED
SEC63 MISSION shRNA Lentiviral Transduction Particles
SEC63 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-254s1c1
Sequence:CCGGCCGAGCAAATTCGATTAAAGACTCGAGTCTTTAATCGAATTTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-2193s1c1
Sequence:CCGGCAAGCCTGGAAATTATCAGTACTCGAGTACTGATAATTTCCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-2263s1c1
Sequence:CCGGCCATTGAAGTTGGAAGTTCATCTCGAGATGAACTTCCAACTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1123s1c1
Sequence:CCGGGCCCTACTTCAAGAAATGGTTCTCGAGAACCATTTCTTGAAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-1560s1c1
Sequence:CCGGGCAAACAATGGCTGAAGTATTCTCGAGAATACTTCAGCCATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1082s1c1
Sequence:CCGGCCCTTGAAGAAGATCAGCAATCTCGAGATTGCTGATCTTCTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-303s1c1
Sequence:CCGGGTGGTATCGTTTACGGTTATTCTCGAGAATAACCGTAAACGATACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007214.2-2088s1c1
Sequence:CCGGGCTTTACATTGCAGATAGGAACTCGAGTTCCTATCTGCAATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007214.2-955s1c1
Sequence:CCGGCCACAGCTAATCAGAGAAATTCTCGAGAATTTCTCTGATTAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007214.2-2101s1c1
Sequence:CCGGGATAGGAAGGAGCAGACATTACTCGAGTAATGTCTGCTCCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007214.2-1786s1c1
Sequence:CCGGGCAAATGGAGTCGTTGGGAATCTCGAGATTCCCAACGACTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1219s21c1
Sequence:CCGGCCCTTGAAGAAGATCAGCAATCTCGAGATTGCTGATCTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1923s21c1
Sequence:CCGGGCAAATGGAGTCGTTGGGAATCTCGAGATTCCCAACGACTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-1260s21c1
Sequence:CCGGGCCCTACTTCAAGAAATGGTTCTCGAGAACCATTTCTTGAAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-440s21c1
Sequence:CCGGGTGGTATCGTTTACGGTTATTCTCGAGAATAACCGTAAACGATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007214.4-2400s21c1
Sequence:CCGGCCATTGAAGTTGGAAGTTCATCTCGAGATGAACTTCCAACTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks