EMAIL THIS PAGE TO A FRIEND

SECTM1

secreted and transmembrane 1

Synonyms: K12
UniProtKB ID: Q8WVN6, B2R7H0, O00466
Gene ID:
Human(6398) Summary: This gene encodes a transmembrane and secreted protein with characteristics of a type 1a transmembrane protein. It is found in a perinuclear Golgi-like pattern and thought to be involved in hematopoietic and/or immune system processes. [provided by RefSeq, Jul 2008]
Rat(287885) secreted and transmembrane 1
cow(781942) secreted and transmembrane 1
sheep(101105766) secreted and transmembrane 1
domestic guinea pig(101787532) secreted and transmembrane 1
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003004 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018821 MISSION® esiRNA esiRNA targeting human SECTM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003004 Rosetta Predictions human pricing
NM_001013043 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334890 predicted 411
2 SASI_Hs01_00051818 predicted 774
3 SASI_Hs01_00051819 predicted 547
4 SASI_Hs01_00051820 predicted 916
5 SASI_Hs01_00051821 predicted 884
6 SASI_Hs01_00051822 predicted 1129
7 SASI_Hs01_00051824 predicted 558
8 SASI_Hs01_00051825 predicted 787
9 SASI_Hs01_00051826 predicted 882
10 SASI_Hs01_00051827 predicted 621
11 SASI_Hs01_00051823 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030645 predicted 371
2 SASI_Rn01_00030646 predicted 716
3 SASI_Rn01_00030647 predicted 1179
4 SASI_Rn01_00030648 predicted 497
5 SASI_Rn02_00200638 predicted 799
6 SASI_Rn01_00030650 predicted 229
7 SASI_Rn01_00030652 predicted 845
8 SASI_Rn01_00030654 predicted 843
9 SASI_Rn02_00200639 predicted 844
10 SASI_Rn02_00200640 predicted 1027
11 SASI_Rn01_00030649 predicted 660
12 SASI_Rn01_00030651 predicted 514
13 SASI_Rn01_00030653 predicted 196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003004
VALIDATED
SECTM1 MISSION shRNA Bacterial Glycerol Stock
secreted and transmembrane 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003004.2-1068s21c1
Sequence:CCGGGTGTTCAAACCCTCACCACTTCTCGAGAAGTGGTGAGGGTTTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003004.2-1958s21c1
Sequence:CCGGCCATGACTCGAATATCTGAAACTCGAGTTTCAGATATTCGAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003004.2-857s21c1
Sequence:CCGGCACTGCTGTCTTCATCCTCTTCTCGAGAAGAGGATGAAGACAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-301s1c1
Sequence:CCGGCTCCCATGTCAACATCAAGCTCTCGAGAGCTTGATGTTGACATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-838s1c1
Sequence:CCGGCTTGTTTCCATATGCCGCAGACTCGAGTCTGCGGCATATGGAAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-788s1c1
Sequence:CCGGGTGTTCAAACCCTCACCACTTCTCGAGAAGTGGTGAGGGTTTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-482s1c1
Sequence:CCGGCACCAGAGAAATAACAGACAACTCGAGTTGTCTGTTATTTCTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003004.1-1677s1c1
Sequence:CCGGCCATGACTCGAATATCTGAAACTCGAGTTTCAGATATTCGAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-653s1c1
Sequence:CCGGGAGAAGAAGTTCTTCCTCCTACTCGAGTAGGAGGAAGAACTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-655s1c1
Sequence:CCGGGAAGAAGTTCTTCCTCCTAGACTCGAGTCTAGGAGGAAGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003004.1-1712s1c1
Sequence:CCGGCGACTCACAAACCTCCAAGTACTCGAGTACTTGGAGGTTTGTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-577s1c1
Sequence:CCGGCACTGCTGTCTTCATCCTCTTCTCGAGAAGAGGATGAAGACAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003004
VALIDATED
SECTM1 MISSION shRNA shRNA Plasmid DNA
secreted and transmembrane 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003004.2-1068s21c1
Sequence:CCGGGTGTTCAAACCCTCACCACTTCTCGAGAAGTGGTGAGGGTTTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003004.2-1958s21c1
Sequence:CCGGCCATGACTCGAATATCTGAAACTCGAGTTTCAGATATTCGAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003004.2-857s21c1
Sequence:CCGGCACTGCTGTCTTCATCCTCTTCTCGAGAAGAGGATGAAGACAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-301s1c1
Sequence:CCGGCTCCCATGTCAACATCAAGCTCTCGAGAGCTTGATGTTGACATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-838s1c1
Sequence:CCGGCTTGTTTCCATATGCCGCAGACTCGAGTCTGCGGCATATGGAAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-788s1c1
Sequence:CCGGGTGTTCAAACCCTCACCACTTCTCGAGAAGTGGTGAGGGTTTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-482s1c1
Sequence:CCGGCACCAGAGAAATAACAGACAACTCGAGTTGTCTGTTATTTCTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003004.1-1677s1c1
Sequence:CCGGCCATGACTCGAATATCTGAAACTCGAGTTTCAGATATTCGAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-653s1c1
Sequence:CCGGGAGAAGAAGTTCTTCCTCCTACTCGAGTAGGAGGAAGAACTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-655s1c1
Sequence:CCGGGAAGAAGTTCTTCCTCCTAGACTCGAGTCTAGGAGGAAGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003004.1-1712s1c1
Sequence:CCGGCGACTCACAAACCTCCAAGTACTCGAGTACTTGGAGGTTTGTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-577s1c1
Sequence:CCGGCACTGCTGTCTTCATCCTCTTCTCGAGAAGAGGATGAAGACAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003004
VALIDATED
SECTM1 MISSION shRNA Lentiviral Transduction Particles
secreted and transmembrane 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003004.2-1068s21c1
Sequence:CCGGGTGTTCAAACCCTCACCACTTCTCGAGAAGTGGTGAGGGTTTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003004.2-1958s21c1
Sequence:CCGGCCATGACTCGAATATCTGAAACTCGAGTTTCAGATATTCGAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003004.2-857s21c1
Sequence:CCGGCACTGCTGTCTTCATCCTCTTCTCGAGAAGAGGATGAAGACAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-301s1c1
Sequence:CCGGCTCCCATGTCAACATCAAGCTCTCGAGAGCTTGATGTTGACATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-838s1c1
Sequence:CCGGCTTGTTTCCATATGCCGCAGACTCGAGTCTGCGGCATATGGAAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-788s1c1
Sequence:CCGGGTGTTCAAACCCTCACCACTTCTCGAGAAGTGGTGAGGGTTTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-482s1c1
Sequence:CCGGCACCAGAGAAATAACAGACAACTCGAGTTGTCTGTTATTTCTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003004.1-1677s1c1
Sequence:CCGGCCATGACTCGAATATCTGAAACTCGAGTTTCAGATATTCGAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-653s1c1
Sequence:CCGGGAGAAGAAGTTCTTCCTCCTACTCGAGTAGGAGGAAGAACTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_003004.1-655s1c1
Sequence:CCGGGAAGAAGTTCTTCCTCCTAGACTCGAGTCTAGGAGGAAGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003004.1-1712s1c1
Sequence:CCGGCGACTCACAAACCTCCAAGTACTCGAGTACTTGGAGGTTTGTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003004.1-577s1c1
Sequence:CCGGCACTGCTGTCTTCATCCTCTTCTCGAGAAGAGGATGAAGACAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks