EMAIL THIS PAGE TO A FRIEND

SEL1L2

sel-1 suppressor of lin-12-like 2 (C. elegans)

Synonyms: C20orf50
UniProtKB ID: Q5TEA6, B4DXX5
Gene ID:
Mouse(228684) sel-1 suppressor of lin-12-like 2 (C. elegans)
Rat(311470) sel-1 suppressor of lin-12-like 2 (C. elegans)
cow(100139737) sel-1 suppressor of lin-12-like 2 (C. elegans)
sheep(101111474) sel-1 suppressor of lin-12-like 2 (C. elegans)
domestic guinea pig(100728453) sel-1 suppressor of lin-12-like 2 (C. elegans)
naked mole-rat(101700850) sel-1 suppressor of lin-12-like 2 (C. elegans)
Horse(100063135) sel-1 suppressor of lin-12-like 2 (C. elegans)
domestic cat(101094751) sel-1 suppressor of lin-12-like 2 (C. elegans)
dog(485763) sel-1 suppressor of lin-12-like 2 (C. elegans)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025229 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141411 MISSION® esiRNA esiRNA human SEL1L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025229 Rosetta Predictions human pricing
XM_046437 Rosetta Predictions human pricing
XM_933095 Rosetta Predictions human pricing
NM_001014049 Rosetta Predictions rat pricing
NM_001033296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358031 predicted 1848
2 SASI_Hs02_00358032 predicted 483
3 SASI_Hs02_00358033 predicted 925
4 SASI_Hs02_00358034 predicted 1300
5 SASI_Hs02_00358035 predicted 1172
6 SASI_Hs02_00358036 predicted 1583
7 SASI_Hs02_00358037 predicted 1990
8 SASI_Hs02_00358038 predicted 571
9 SASI_Hs02_00358039 predicted 1306
10 SASI_Hs02_00358040 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_046437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268806 predicted 1033
2 SASI_Hs01_00268807 predicted 1141
3 SASI_Hs01_00268808 predicted 1417
4 SASI_Hs01_00268809 predicted 1292
5 SASI_Hs01_00268810 predicted 1699
6 SASI_Hs01_00268811 predicted 917
7 SASI_Hs01_00268812 predicted 2110
8 SASI_Hs01_00268813 predicted 685
9 SASI_Hs01_00268814 predicted 1429
10 SASI_Hs01_00268815 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293241 predicted 533
2 SASI_Hs01_00293242 predicted 976
3 SASI_Hs01_00293243 predicted 1075
4 SASI_Hs01_00293244 predicted 1353
5 SASI_Hs01_00293245 predicted 1230
6 SASI_Hs01_00293246 predicted 857
7 SASI_Hs01_00293247 predicted 622
8 SASI_Hs01_00293248 predicted 1360
9 SASI_Hs01_00293249 predicted 543
10 SASI_Hs01_00293250 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108557 predicted 1767
2 SASI_Rn01_00108558 predicted 559
3 SASI_Rn01_00108559 predicted 1836
4 SASI_Rn01_00108561 predicted 1885
5 SASI_Rn01_00108562 predicted 1294
6 SASI_Rn01_00108563 predicted 586
7 SASI_Rn01_00108564 predicted 1699
8 SASI_Rn01_00108565 predicted 634
9 SASI_Rn02_00201441 predicted 810
10 SASI_Rn01_00108566 predicted 912
11 SASI_Rn01_00108560 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041254 predicted 741
2 SASI_Mm01_00041255 predicted 801
3 SASI_Mm01_00041256 predicted 596
4 SASI_Mm01_00041257 predicted 809
5 SASI_Mm01_00041258 predicted 1769
6 SASI_Mm02_00288496 predicted 1840
7 SASI_Mm01_00041260 predicted 1863
8 SASI_Mm02_00288497 predicted 954
9 SASI_Mm01_00041261 predicted 1711
10 SASI_Mm01_00041262 predicted 679
11 SASI_Mm01_00041259 predicted 1790
12 SASI_Mm01_00041263 predicted 1115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033296
SEL1L2 MISSION shRNA Bacterial Glycerol Stock
sel-1 suppressor of lin-12-like 2 (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1531s21c1
Sequence:CCGGACGGCCTATTTCGCCTATAAGCTCGAGCTTATAGGCGAAATAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1026s21c1
Sequence:CCGGAGATTACAGTAAGGCGTTATACTCGAGTATAACGCCTTACTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1341s21c1
Sequence:CCGGTGGAGTATGGAAGGATTATAACTCGAGTTATAATCCTTCCATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-673s21c1
Sequence:CCGGCAAGCCAAGGCACTGATATATCTCGAGATATATCAGTGCCTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1849s21c1
Sequence:CCGGATGTTCAACCTGGCATATATGCTCGAGCATATATGCCAGGTTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033296
SEL1L2 MISSION shRNA shRNA Plasmid DNA
sel-1 suppressor of lin-12-like 2 (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1531s21c1
Sequence:CCGGACGGCCTATTTCGCCTATAAGCTCGAGCTTATAGGCGAAATAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1026s21c1
Sequence:CCGGAGATTACAGTAAGGCGTTATACTCGAGTATAACGCCTTACTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1341s21c1
Sequence:CCGGTGGAGTATGGAAGGATTATAACTCGAGTTATAATCCTTCCATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-673s21c1
Sequence:CCGGCAAGCCAAGGCACTGATATATCTCGAGATATATCAGTGCCTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1849s21c1
Sequence:CCGGATGTTCAACCTGGCATATATGCTCGAGCATATATGCCAGGTTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033296
SEL1L2 MISSION shRNA Lentiviral Transduction Particles
sel-1 suppressor of lin-12-like 2 (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1531s21c1
Sequence:CCGGACGGCCTATTTCGCCTATAAGCTCGAGCTTATAGGCGAAATAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1026s21c1
Sequence:CCGGAGATTACAGTAAGGCGTTATACTCGAGTATAACGCCTTACTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1341s21c1
Sequence:CCGGTGGAGTATGGAAGGATTATAACTCGAGTTATAATCCTTCCATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-673s21c1
Sequence:CCGGCAAGCCAAGGCACTGATATATCTCGAGATATATCAGTGCCTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033296.2-1849s21c1
Sequence:CCGGATGTTCAACCTGGCATATATGCTCGAGCATATATGCCAGGTTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025229
SEL1L2 MISSION shRNA Bacterial Glycerol Stock
sel-1 suppressor of lin-12-like 2 (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-239s21c1
Sequence:CCGGGAACAAAGAACATCTAGTAATCTCGAGATTACTAGATGTTCTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-677s21c1
Sequence:CCGGCAAGCTAAGGCACTGATATATCTCGAGATATATCAGTGCCTTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-2072s21c1
Sequence:CCGGGGACCACACTGGGACTTATTTCTCGAGAAATAAGTCCCAGTGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-569s21c1
Sequence:CCGGATAACAGCAGCTATCCAATTACTCGAGTAATTGGATAGCTGCTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-1997s21c1
Sequence:CCGGACGCATTTGCTCCGGGATATCCTCGAGGATATCCCGGAGCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025229
SEL1L2 MISSION shRNA shRNA Plasmid DNA
sel-1 suppressor of lin-12-like 2 (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-239s21c1
Sequence:CCGGGAACAAAGAACATCTAGTAATCTCGAGATTACTAGATGTTCTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-677s21c1
Sequence:CCGGCAAGCTAAGGCACTGATATATCTCGAGATATATCAGTGCCTTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-2072s21c1
Sequence:CCGGGGACCACACTGGGACTTATTTCTCGAGAAATAAGTCCCAGTGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-569s21c1
Sequence:CCGGATAACAGCAGCTATCCAATTACTCGAGTAATTGGATAGCTGCTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-1997s21c1
Sequence:CCGGACGCATTTGCTCCGGGATATCCTCGAGGATATCCCGGAGCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025229
SEL1L2 MISSION shRNA Lentiviral Transduction Particles
sel-1 suppressor of lin-12-like 2 (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-239s21c1
Sequence:CCGGGAACAAAGAACATCTAGTAATCTCGAGATTACTAGATGTTCTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-677s21c1
Sequence:CCGGCAAGCTAAGGCACTGATATATCTCGAGATATATCAGTGCCTTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-2072s21c1
Sequence:CCGGGGACCACACTGGGACTTATTTCTCGAGAAATAAGTCCCAGTGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-569s21c1
Sequence:CCGGATAACAGCAGCTATCCAATTACTCGAGTAATTGGATAGCTGCTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025229.1-1997s21c1
Sequence:CCGGACGCATTTGCTCCGGGATATCCTCGAGGATATCCCGGAGCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks