EMAIL THIS PAGE TO A FRIEND

SELV

UniProtKB ID: P59797, Q17RG5
Gene ID:
Human(348303) Summary: This gene encodes a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
Rat(499113) selenoprotein V
dog(100303414) selenoprotein V
Horse(100067671) selenoprotein V
cow(615288) selenoprotein V
Domestic Rabbit(100339637) selenoprotein V
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182704 Rosetta Predictions human pricing
XM_574408 Rosetta Predictions rat pricing
XR_009209 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190517 predicted 910
2 SASI_Hs01_00190518 predicted 1037
3 SASI_Hs01_00190519 predicted 1328
4 SASI_Hs01_00190520 predicted 1191
5 SASI_Hs01_00190521 predicted 1179
6 SASI_Hs01_00190522 predicted 1256
7 SASI_Hs01_00190523 predicted 1065
8 SASI_Hs01_00190524 predicted 922
9 SASI_Hs01_00190525 predicted 1336
10 SASI_Hs01_00190526 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170039 predicted 940
2 SASI_Rn01_00170040 predicted 970
3 SASI_Rn01_00170041 predicted 777
4 SASI_Rn01_00170042 predicted 826
5 SASI_Rn01_00170043 predicted 365
6 SASI_Rn01_00170044 predicted 442
7 SASI_Rn01_00170045 predicted 910
8 SASI_Rn01_00170046 predicted 360
9 SASI_Rn01_00170047 predicted 862
10 SASI_Rn01_00170048 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154121 predicted 928
2 SASI_Rn01_00154122 predicted 74
3 SASI_Rn01_00154123 predicted 813
4 SASI_Rn01_00154124 predicted 356
5 SASI_Rn01_00154125 predicted 770
6 SASI_Rn01_00154126 predicted 328
7 SASI_Rn01_00154127 predicted 886
8 SASI_Rn01_00154128 predicted 961
9 SASI_Rn01_00154129 predicted 359
10 SASI_Rn01_00154130 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182704
SELV MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-890s1c1
Sequence:CCGGCTGATTCGAGTGACCTACTGTCTCGAGACAGTAGGTCACTCGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182704.1-1510s1c1
Sequence:CCGGCCTTCCATCTTATTGGCATTTCTCGAGAAATGCCAATAAGATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-819s1c1
Sequence:CCGGCCATCTCCTTACAGAATTGTACTCGAGTACAATTCTGTAAGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-1111s1c1
Sequence:CCGGCGTTATCGATGAGGAAATCAACTCGAGTTGATTTCCTCATCGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-818s1c1
Sequence:CCGGGCCATCTCCTTACAGAATTGTCTCGAGACAATTCTGTAAGGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-961s1c1
Sequence:CCGGGCAGCAATTTCCGAATCACCTCTCGAGAGGTGATTCGGAAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161546    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182704.1-1176s1c1
Sequence:CCGGGATGATGAGAAGGGCTGAAATCTCGAGATTTCAGCCCTTCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-962s1c1
Sequence:CCGGCAGCAATTTCCGAATCACCTACTCGAGTAGGTGATTCGGAAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182704
SELV MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-890s1c1
Sequence:CCGGCTGATTCGAGTGACCTACTGTCTCGAGACAGTAGGTCACTCGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182704.1-1510s1c1
Sequence:CCGGCCTTCCATCTTATTGGCATTTCTCGAGAAATGCCAATAAGATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-819s1c1
Sequence:CCGGCCATCTCCTTACAGAATTGTACTCGAGTACAATTCTGTAAGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-1111s1c1
Sequence:CCGGCGTTATCGATGAGGAAATCAACTCGAGTTGATTTCCTCATCGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-818s1c1
Sequence:CCGGGCCATCTCCTTACAGAATTGTCTCGAGACAATTCTGTAAGGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-961s1c1
Sequence:CCGGGCAGCAATTTCCGAATCACCTCTCGAGAGGTGATTCGGAAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161546    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182704.1-1176s1c1
Sequence:CCGGGATGATGAGAAGGGCTGAAATCTCGAGATTTCAGCCCTTCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-962s1c1
Sequence:CCGGCAGCAATTTCCGAATCACCTACTCGAGTAGGTGATTCGGAAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182704
SELV MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-890s1c1
Sequence:CCGGCTGATTCGAGTGACCTACTGTCTCGAGACAGTAGGTCACTCGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182704.1-1510s1c1
Sequence:CCGGCCTTCCATCTTATTGGCATTTCTCGAGAAATGCCAATAAGATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-819s1c1
Sequence:CCGGCCATCTCCTTACAGAATTGTACTCGAGTACAATTCTGTAAGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-1111s1c1
Sequence:CCGGCGTTATCGATGAGGAAATCAACTCGAGTTGATTTCCTCATCGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-818s1c1
Sequence:CCGGGCCATCTCCTTACAGAATTGTCTCGAGACAATTCTGTAAGGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-961s1c1
Sequence:CCGGGCAGCAATTTCCGAATCACCTCTCGAGAGGTGATTCGGAAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161546    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182704.1-1176s1c1
Sequence:CCGGGATGATGAGAAGGGCTGAAATCTCGAGATTTCAGCCCTTCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182704.1-962s1c1
Sequence:CCGGCAGCAATTTCCGAATCACCTACTCGAGTAGGTGATTCGGAAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks