EMAIL THIS PAGE TO A FRIEND

SEMA4B

sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B

Synonyms: SEMAC SemC
Gene ID:
Mouse(20352) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Rat(293042) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
chicken(415582) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
domestic cat(101089108) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Horse(100069054) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
dog(488741) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
naked mole-rat(101710342) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
domestic guinea pig(100728909) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
cow(510140) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
sheep(101103596) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020210 Rosetta Predictions human pricing
NM_198925 Rosetta Predictions human pricing
XM_001065817 Rosetta Predictions rat pricing
XM_001065984 Rosetta Predictions rat pricing
NM_013659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233094 predicted 3031
2 SASI_Hs01_00233095 predicted 2503
3 SASI_Hs01_00233096 predicted 3110
4 SASI_Hs01_00233097 predicted 2677
5 SASI_Hs01_00233098 predicted 755
6 SASI_Hs01_00233101 predicted 881
7 SASI_Hs01_00233102 predicted 1092
8 SASI_Hs01_00233103 predicted 1810
9 SASI_Hs02_00353145 predicted 2326
10 SASI_Hs01_00233099 predicted 3099
11 SASI_Hs01_00233100 predicted 2674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207001 predicted 2998
2 SASI_Hs01_00207002 predicted 2475
3 SASI_Hs01_00207003 predicted 3076
4 SASI_Hs01_00207004 predicted 2636
5 SASI_Hs01_00207005 predicted 721
6 SASI_Hs01_00207008 predicted 851
7 SASI_Hs01_00207009 predicted 1058
8 SASI_Hs01_00207010 predicted 1767
9 SASI_Hs02_00372417 predicted 2291
10 SASI_Hs01_00207006 predicted 3061
11 SASI_Hs01_00207007 predicted 2637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315441 predicted 1220
2 SASI_Rn02_00315442 predicted 1831
3 SASI_Rn02_00315443 predicted 1213
4 SASI_Rn02_00315444 predicted 1077
5 SASI_Rn02_00315445 predicted 1064
6 SASI_Rn02_00315446 predicted 1395
7 SASI_Rn02_00315447 predicted 623
8 SASI_Rn02_00315448 predicted 724
9 SASI_Rn02_00315449 predicted 1265
10 SASI_Rn02_00315450 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315981 predicted 2536
2 SASI_Rn02_00315982 predicted 1149
3 SASI_Rn02_00315983 predicted 2524
4 SASI_Rn02_00315984 predicted 1005
5 SASI_Rn02_00315985 predicted 2612
6 SASI_Rn02_00315986 predicted 2774
7 SASI_Rn02_00315987 predicted 994
8 SASI_Rn02_00315988 predicted 2813
9 SASI_Rn02_00315989 predicted 1325
10 SASI_Rn02_00315990 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322482 predicted 1617
2 SASI_Mm02_00322483 predicted 1004
3 SASI_Mm02_00322484 predicted 939
4 SASI_Mm02_00322485 predicted 1980
5 SASI_Mm02_00322486 predicted 748
6 SASI_Mm02_00322487 predicted 2386
7 SASI_Mm02_00322488 predicted 1993
8 SASI_Mm02_00322489 predicted 2627
9 SASI_Mm02_00322490 predicted 2741
10 SASI_Mm02_00322491 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020210
VALIDATED
SEMA4B MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020210.3-3231s21c1
Sequence:CCGGCTCTTCACCTTCCACATTATCCTCGAGGATAATGTGGAAGGTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020210.3-2340s21c1
Sequence:CCGGGTGGCAGTGTACCCGTCATTACTCGAGTAATGACGGGTACACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020210.3-3041s21c1
Sequence:CCGGGAACAGTGCTCCTTATGTAAACTCGAGTTTACATAAGGAGCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020210.3-2439s21c1
Sequence:CCGGTGGTGATGTGCACGCTCTTTGCTCGAGCAAAGAGCGTGCACATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-469s1c1
Sequence:CCGGCGAAGCTGAACACATCTCCAACTCGAGTTGGAGATGTGTTCAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-2498s1c1
Sequence:CCGGCGGCACCGGAACAGCATGAAACTCGAGTTTCATGCTGTTCCGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020210.2-751s1c1
Sequence:CCGGCATGTGTACCTACATCAACATCTCGAGATGTTGATGTAGGTACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020210.2-1534s1c1
Sequence:CCGGCCGCGTGCTGAACTTCCTCAACTCGAGTTGAGGAAGTTCAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-1048s1c1
Sequence:CCGGCGATGATGACAAGATCTACTTCTCGAGAAGTAGATCTTGTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020210
VALIDATED
SEMA4B MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020210.3-3231s21c1
Sequence:CCGGCTCTTCACCTTCCACATTATCCTCGAGGATAATGTGGAAGGTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020210.3-2340s21c1
Sequence:CCGGGTGGCAGTGTACCCGTCATTACTCGAGTAATGACGGGTACACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020210.3-3041s21c1
Sequence:CCGGGAACAGTGCTCCTTATGTAAACTCGAGTTTACATAAGGAGCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020210.3-2439s21c1
Sequence:CCGGTGGTGATGTGCACGCTCTTTGCTCGAGCAAAGAGCGTGCACATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-469s1c1
Sequence:CCGGCGAAGCTGAACACATCTCCAACTCGAGTTGGAGATGTGTTCAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-2498s1c1
Sequence:CCGGCGGCACCGGAACAGCATGAAACTCGAGTTTCATGCTGTTCCGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020210.2-751s1c1
Sequence:CCGGCATGTGTACCTACATCAACATCTCGAGATGTTGATGTAGGTACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020210.2-1534s1c1
Sequence:CCGGCCGCGTGCTGAACTTCCTCAACTCGAGTTGAGGAAGTTCAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-1048s1c1
Sequence:CCGGCGATGATGACAAGATCTACTTCTCGAGAAGTAGATCTTGTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020210
VALIDATED
SEMA4B MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020210.3-3231s21c1
Sequence:CCGGCTCTTCACCTTCCACATTATCCTCGAGGATAATGTGGAAGGTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020210.3-2340s21c1
Sequence:CCGGGTGGCAGTGTACCCGTCATTACTCGAGTAATGACGGGTACACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020210.3-3041s21c1
Sequence:CCGGGAACAGTGCTCCTTATGTAAACTCGAGTTTACATAAGGAGCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020210.3-2439s21c1
Sequence:CCGGTGGTGATGTGCACGCTCTTTGCTCGAGCAAAGAGCGTGCACATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-469s1c1
Sequence:CCGGCGAAGCTGAACACATCTCCAACTCGAGTTGGAGATGTGTTCAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-2498s1c1
Sequence:CCGGCGGCACCGGAACAGCATGAAACTCGAGTTTCATGCTGTTCCGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020210.2-751s1c1
Sequence:CCGGCATGTGTACCTACATCAACATCTCGAGATGTTGATGTAGGTACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020210.2-1534s1c1
Sequence:CCGGCCGCGTGCTGAACTTCCTCAACTCGAGTTGAGGAAGTTCAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020210.2-1048s1c1
Sequence:CCGGCGATGATGACAAGATCTACTTCTCGAGAAGTAGATCTTGTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013659
VALIDATED
SEMA4B MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013659.3-2963s21c1
Sequence:CCGGGGCAGAACTCTGCTACTTAACCTCGAGGTTAAGTAGCAGAGTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-1622s21c1
Sequence:CCGGGCACTTATGATGTCCTATTTCCTCGAGGAAATAGGACATCATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-2749s21c1
Sequence:CCGGGTGGTATGAGAGCTGACTTTACTCGAGTAAAGTCAGCTCTCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-2022s21c1
Sequence:CCGGGCCATGTAAACAAGTCCAGATCTCGAGATCTGGACTTGTTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013659.4-3037s21c1
Sequence:CCGGACAAGGAAGACTACAACATAGCTCGAGCTATGTTGTAGTCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.4-1003s21c1
Sequence:CCGGCCCATAGGTGATGATGATAAGCTCGAGCTTATCATCATCACCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013659.4-1621s21c1
Sequence:CCGGAGCACTTATGATGTCCTATTTCTCGAGAAATAGGACATCATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-404s1c1
Sequence:CCGGGCTGTCAAGAAAGGCTGATTACTCGAGTAATCAGCCTTTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-736s1c1
Sequence:CCGGGCGAGCTTTACTTTAGCCCAACTCGAGTTGGGCTAAAGTAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013659.1-2022s1c1
Sequence:CCGGGCCATGTAAACAAGTCCAGATCTCGAGATCTGGACTTGTTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013659.1-3627s1c1
Sequence:CCGGCCACCCATCTTCTAATTCCTACTCGAGTAGGAATTAGAAGATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-1198s1c1
Sequence:CCGGCCCTTTAACGTGCTACAAGATCTCGAGATCTTGTAGCACGTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013659
VALIDATED
SEMA4B MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013659.3-2963s21c1
Sequence:CCGGGGCAGAACTCTGCTACTTAACCTCGAGGTTAAGTAGCAGAGTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-1622s21c1
Sequence:CCGGGCACTTATGATGTCCTATTTCCTCGAGGAAATAGGACATCATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-2749s21c1
Sequence:CCGGGTGGTATGAGAGCTGACTTTACTCGAGTAAAGTCAGCTCTCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-2022s21c1
Sequence:CCGGGCCATGTAAACAAGTCCAGATCTCGAGATCTGGACTTGTTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013659.4-3037s21c1
Sequence:CCGGACAAGGAAGACTACAACATAGCTCGAGCTATGTTGTAGTCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.4-1003s21c1
Sequence:CCGGCCCATAGGTGATGATGATAAGCTCGAGCTTATCATCATCACCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013659.4-1621s21c1
Sequence:CCGGAGCACTTATGATGTCCTATTTCTCGAGAAATAGGACATCATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-404s1c1
Sequence:CCGGGCTGTCAAGAAAGGCTGATTACTCGAGTAATCAGCCTTTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-736s1c1
Sequence:CCGGGCGAGCTTTACTTTAGCCCAACTCGAGTTGGGCTAAAGTAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013659.1-2022s1c1
Sequence:CCGGGCCATGTAAACAAGTCCAGATCTCGAGATCTGGACTTGTTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013659.1-3627s1c1
Sequence:CCGGCCACCCATCTTCTAATTCCTACTCGAGTAGGAATTAGAAGATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-1198s1c1
Sequence:CCGGCCCTTTAACGTGCTACAAGATCTCGAGATCTTGTAGCACGTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013659
VALIDATED
SEMA4B MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013659.3-2963s21c1
Sequence:CCGGGGCAGAACTCTGCTACTTAACCTCGAGGTTAAGTAGCAGAGTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-1622s21c1
Sequence:CCGGGCACTTATGATGTCCTATTTCCTCGAGGAAATAGGACATCATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-2749s21c1
Sequence:CCGGGTGGTATGAGAGCTGACTTTACTCGAGTAAAGTCAGCTCTCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.3-2022s21c1
Sequence:CCGGGCCATGTAAACAAGTCCAGATCTCGAGATCTGGACTTGTTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013659.4-3037s21c1
Sequence:CCGGACAAGGAAGACTACAACATAGCTCGAGCTATGTTGTAGTCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013659.4-1003s21c1
Sequence:CCGGCCCATAGGTGATGATGATAAGCTCGAGCTTATCATCATCACCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013659.4-1621s21c1
Sequence:CCGGAGCACTTATGATGTCCTATTTCTCGAGAAATAGGACATCATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-404s1c1
Sequence:CCGGGCTGTCAAGAAAGGCTGATTACTCGAGTAATCAGCCTTTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-736s1c1
Sequence:CCGGGCGAGCTTTACTTTAGCCCAACTCGAGTTGGGCTAAAGTAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013659.1-2022s1c1
Sequence:CCGGGCCATGTAAACAAGTCCAGATCTCGAGATCTGGACTTGTTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013659.1-3627s1c1
Sequence:CCGGCCACCCATCTTCTAATTCCTACTCGAGTAGGAATTAGAAGATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013659.1-1198s1c1
Sequence:CCGGCCCTTTAACGTGCTACAAGATCTCGAGATCTTGTAGCACGTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks