EMAIL THIS PAGE TO A FRIEND

SENP3

SUMO1/sentrin/SMT3 specific peptidase 3

Synonyms: SMT3IP1 SSP3 Ulp1
UniProtKB ID: Q9H4L4, Q66K15, Q86VS7, Q96PS4, Q9Y3W9
Gene ID:
Human(26168) Summary: The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP3, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]
Mouse(80886) SUMO/sentrin specific peptidase 3
Rat(303245) Sumo1/sentrin/SMT3 specific peptidase 3
domestic cat(101097929) SUMO1/sentrin/SMT3 specific peptidase 3
dog(607655) SUMO1/sentrin/SMT3 specific peptidase 3
Horse(100061934) SUMO1/sentrin/SMT3 specific peptidase 3
cow(100138267) SUMO1/sentrin/SMT3 specific peptidase 3
sheep(101119147) SUMO1/sentrin/SMT3 specific peptidase 3
naked mole-rat(101725959) SUMO1/sentrin/SMT3 specific peptidase 3
Domestic Rabbit(100356136) SUMO1/sentrin/SMT3 specific peptidase 3
domestic guinea pig(100712993) SUMO1/sentrin/SMT3 specific peptidase 3
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043671 MISSION® esiRNA esiRNA human SENP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015670 Rosetta Predictions human pricing
NM_001013116 Rosetta Predictions rat pricing
NM_030702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092168 predicted 1658
2 SASI_Hs01_00092171 predicted 1063
3 SASI_Hs01_00092170 predicted 1237
4 SASI_Hs01_00092172 predicted 1899
5 SASI_Hs02_00348302 predicted 1220
6 SASI_Hs01_00092173 predicted 1672
7 SASI_Hs01_00092174 predicted 1272
8 SASI_Hs01_00092175 predicted 1728
9 SASI_Hs02_00348303 predicted 1533
10 SASI_Hs01_00092167 predicted 1208
11 SASI_Hs01_00092169 predicted 1221
12 SASI_Hs01_00092176 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200805 predicted 1226
2 SASI_Rn02_00200806 predicted 1628
3 SASI_Rn02_00200807 predicted 1104
4 SASI_Rn02_00200808 predicted 869
5 SASI_Rn02_00200809 predicted 1589
6 SASI_Rn02_00200810 predicted 1374
7 SASI_Rn02_00200811 predicted 1413
8 SASI_Rn02_00200812 predicted 1339
9 SASI_Rn02_00200813 predicted 1351
10 SASI_Rn02_00200814 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022547 predicted 1575
2 SASI_Mm02_00336872 predicted 1716
3 SASI_Mm01_00022549 predicted 893
4 SASI_Mm01_00022550 predicted 1122
5 SASI_Mm01_00022551 predicted 1249
6 SASI_Mm01_00022552 predicted 1363
7 SASI_Mm01_00022546 predicted 1642
8 SASI_Mm01_00022553 predicted 1376
9 SASI_Mm01_00022554 predicted 1628
10 SASI_Mm02_00336873 predicted 308
11 SASI_Mm01_00022548 predicted 1040
12 SASI_Mm01_00022555 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015670
VALIDATED
SENP3 MISSION shRNA Bacterial Glycerol Stock
SUMO1/sentrin/SMT3 specific peptidase 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-1463s1c1
Sequence:CCGGCATTGGTCCCTCATCTCTGTTCTCGAGAACAGAGATGAGGGACCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-495s1c1
Sequence:CCGGCCTCGCTGACATTCCACTGGACTCGAGTCCAGTGGAATGTCAGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015670.x-1042s1c1
Sequence:CCGGCCTTCAAACGTATGGCAGCCTCTCGAGAGGCTGCCATACGTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-1879s1c1
Sequence:CCGGCTTGCCTCTTCCCACTCACTTCTCGAGAAGTGAGTGGGAAGAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015670.x-1580s1c1
Sequence:CCGGGTAAAGAAAGACCGACTGGATCTCGAGATCCAGTCGGTCTTTCTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015670.4-2154s21c1
Sequence:CCGGTGAGAGAATACTTGTTGATTTCTCGAGAAATCAACAAGTATTCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1695s21c1
Sequence:CCGGGCGACGCACCATCACCTATTTCTCGAGAAATAGGTGATGGTGCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015670.4-2329s21c1
Sequence:CCGGCTGCCTGCCAGATCTTCAAACCTCGAGGTTTGAAGATCTGGCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1626s21c1
Sequence:CCGGCAATAAGGAGCTACTGCTAATCTCGAGATTAGCAGTAGCTCCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1835s21c1
Sequence:CCGGTGAATGTGGCCAGGCAGAATACTCGAGTATTCTGCCTGGCCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1767s21c1
Sequence:CCGGTCTACAGGCAGAGGCGGTAAACTCGAGTTTACCGCCTCTGCCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015670
VALIDATED
SENP3 MISSION shRNA shRNA Plasmid DNA
SUMO1/sentrin/SMT3 specific peptidase 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-1463s1c1
Sequence:CCGGCATTGGTCCCTCATCTCTGTTCTCGAGAACAGAGATGAGGGACCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-495s1c1
Sequence:CCGGCCTCGCTGACATTCCACTGGACTCGAGTCCAGTGGAATGTCAGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015670.x-1042s1c1
Sequence:CCGGCCTTCAAACGTATGGCAGCCTCTCGAGAGGCTGCCATACGTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-1879s1c1
Sequence:CCGGCTTGCCTCTTCCCACTCACTTCTCGAGAAGTGAGTGGGAAGAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015670.x-1580s1c1
Sequence:CCGGGTAAAGAAAGACCGACTGGATCTCGAGATCCAGTCGGTCTTTCTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015670.4-2154s21c1
Sequence:CCGGTGAGAGAATACTTGTTGATTTCTCGAGAAATCAACAAGTATTCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1695s21c1
Sequence:CCGGGCGACGCACCATCACCTATTTCTCGAGAAATAGGTGATGGTGCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015670.4-2329s21c1
Sequence:CCGGCTGCCTGCCAGATCTTCAAACCTCGAGGTTTGAAGATCTGGCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1626s21c1
Sequence:CCGGCAATAAGGAGCTACTGCTAATCTCGAGATTAGCAGTAGCTCCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1835s21c1
Sequence:CCGGTGAATGTGGCCAGGCAGAATACTCGAGTATTCTGCCTGGCCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1767s21c1
Sequence:CCGGTCTACAGGCAGAGGCGGTAAACTCGAGTTTACCGCCTCTGCCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015670
VALIDATED
SENP3 MISSION shRNA Lentiviral Transduction Particles
SUMO1/sentrin/SMT3 specific peptidase 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-1463s1c1
Sequence:CCGGCATTGGTCCCTCATCTCTGTTCTCGAGAACAGAGATGAGGGACCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-495s1c1
Sequence:CCGGCCTCGCTGACATTCCACTGGACTCGAGTCCAGTGGAATGTCAGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015670.x-1042s1c1
Sequence:CCGGCCTTCAAACGTATGGCAGCCTCTCGAGAGGCTGCCATACGTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015670.x-1879s1c1
Sequence:CCGGCTTGCCTCTTCCCACTCACTTCTCGAGAAGTGAGTGGGAAGAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015670.x-1580s1c1
Sequence:CCGGGTAAAGAAAGACCGACTGGATCTCGAGATCCAGTCGGTCTTTCTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015670.4-2154s21c1
Sequence:CCGGTGAGAGAATACTTGTTGATTTCTCGAGAAATCAACAAGTATTCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1695s21c1
Sequence:CCGGGCGACGCACCATCACCTATTTCTCGAGAAATAGGTGATGGTGCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015670.4-2329s21c1
Sequence:CCGGCTGCCTGCCAGATCTTCAAACCTCGAGGTTTGAAGATCTGGCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1626s21c1
Sequence:CCGGCAATAAGGAGCTACTGCTAATCTCGAGATTAGCAGTAGCTCCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1835s21c1
Sequence:CCGGTGAATGTGGCCAGGCAGAATACTCGAGTATTCTGCCTGGCCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015670.4-1767s21c1
Sequence:CCGGTCTACAGGCAGAGGCGGTAAACTCGAGTTTACCGCCTCTGCCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030702
VALIDATED
SENP3 MISSION shRNA Bacterial Glycerol Stock
SUMO1/sentrin/SMT3 specific peptidase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-608s1c1
Sequence:CCGGCTGACATTCCACTGGAAGCTTCTCGAGAAGCTTCCAGTGGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030702.2-1652s1c1
Sequence:CCGGCCTAAGCATATTGCCAAGTATCTCGAGATACTTGGCAATATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-1129s1c1
Sequence:CCGGGCAGAGTATCTTAGATGAATTCTCGAGAATTCATCTAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-974s1c1
Sequence:CCGGGCCAGCATACTCATCAGTAATCTCGAGATTACTGATGAGTATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-1453s1c1
Sequence:CCGGCAACAGCTTCTTCTATGATAACTCGAGTTATCATAGAAGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-973s21c1
Sequence:CCGGGCCAGCATACTCATCAGTAATCTCGAGATTACTGATGAGTATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-1128s21c1
Sequence:CCGGGCAGAGTATCTTAGATGAATTCTCGAGAATTCATCTAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-607s21c1
Sequence:CCGGCTGACATTCCACTGGAAGCTTCTCGAGAAGCTTCCAGTGGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-1452s21c1
Sequence:CCGGCAACAGCTTCTTCTATGATAACTCGAGTTATCATAGAAGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-2047s21c1
Sequence:CCGGTTGCTGCGAGTATATTGATTTCTCGAGAAATCAATATACTCGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030702
VALIDATED
SENP3 MISSION shRNA shRNA Plasmid DNA
SUMO1/sentrin/SMT3 specific peptidase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-608s1c1
Sequence:CCGGCTGACATTCCACTGGAAGCTTCTCGAGAAGCTTCCAGTGGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030702.2-1652s1c1
Sequence:CCGGCCTAAGCATATTGCCAAGTATCTCGAGATACTTGGCAATATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-1129s1c1
Sequence:CCGGGCAGAGTATCTTAGATGAATTCTCGAGAATTCATCTAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-974s1c1
Sequence:CCGGGCCAGCATACTCATCAGTAATCTCGAGATTACTGATGAGTATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-1453s1c1
Sequence:CCGGCAACAGCTTCTTCTATGATAACTCGAGTTATCATAGAAGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-973s21c1
Sequence:CCGGGCCAGCATACTCATCAGTAATCTCGAGATTACTGATGAGTATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-1128s21c1
Sequence:CCGGGCAGAGTATCTTAGATGAATTCTCGAGAATTCATCTAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-607s21c1
Sequence:CCGGCTGACATTCCACTGGAAGCTTCTCGAGAAGCTTCCAGTGGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-1452s21c1
Sequence:CCGGCAACAGCTTCTTCTATGATAACTCGAGTTATCATAGAAGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-2047s21c1
Sequence:CCGGTTGCTGCGAGTATATTGATTTCTCGAGAAATCAATATACTCGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030702
VALIDATED
SENP3 MISSION shRNA Lentiviral Transduction Particles
SUMO1/sentrin/SMT3 specific peptidase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-608s1c1
Sequence:CCGGCTGACATTCCACTGGAAGCTTCTCGAGAAGCTTCCAGTGGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030702.2-1652s1c1
Sequence:CCGGCCTAAGCATATTGCCAAGTATCTCGAGATACTTGGCAATATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-1129s1c1
Sequence:CCGGGCAGAGTATCTTAGATGAATTCTCGAGAATTCATCTAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-974s1c1
Sequence:CCGGGCCAGCATACTCATCAGTAATCTCGAGATTACTGATGAGTATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030702.2-1453s1c1
Sequence:CCGGCAACAGCTTCTTCTATGATAACTCGAGTTATCATAGAAGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-973s21c1
Sequence:CCGGGCCAGCATACTCATCAGTAATCTCGAGATTACTGATGAGTATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-1128s21c1
Sequence:CCGGGCAGAGTATCTTAGATGAATTCTCGAGAATTCATCTAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-607s21c1
Sequence:CCGGCTGACATTCCACTGGAAGCTTCTCGAGAAGCTTCCAGTGGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-1452s21c1
Sequence:CCGGCAACAGCTTCTTCTATGATAACTCGAGTTATCATAGAAGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030702.3-2047s21c1
Sequence:CCGGTTGCTGCGAGTATATTGATTTCTCGAGAAATCAATATACTCGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks