EMAIL THIS PAGE TO A FRIEND

SEPT8

septin 8

Synonyms: SEP2
UniProtKB ID: Q92599, A6NC65, A6NKP6, Q8IX36, Q8IX37, Q9BVB3
Gene ID:
Human(23176) Summary: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. [provided by RefSeq, Jun 2012]
Mouse(20362) septin 8
Rat(303135) septin 8
chicken(416333) septin 8
dog(474677) septin 8
Horse(100063132) septin 8
cow(540614) septin 8
sheep(101122277) septin 8
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702108 Anti-SEPT8 antibody produced in rabbit human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500954 Anti-SEPT8 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB1402551 Monoclonal Anti-40429 antibody produced in mouse clone 1G3-7D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404956 Monoclonal Anti-SEPT8 antibody produced in mouse clone 3G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001098811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098811 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088851 MISSION® esiRNA esiRNA human SEPT8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098811 Rosetta Predictions human pricing
NM_001098812 Rosetta Predictions human pricing
NM_001098813 Rosetta Predictions human pricing
NM_015146 Rosetta Predictions human pricing
XM_034872 Rosetta Predictions human pricing
XM_928792 Rosetta Predictions human pricing
XM_933151 Rosetta Predictions human pricing
NM_001107002 Rosetta Predictions rat pricing
NM_033144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319964 predicted 594
2 SASI_Hs02_00319965 predicted 1204
3 SASI_Hs02_00319966 predicted 507
4 SASI_Hs02_00319967 predicted 1064
5 SASI_Hs02_00319968 predicted 670
6 SASI_Hs02_00319969 predicted 1061
7 SASI_Hs02_00319970 predicted 679
8 SASI_Hs02_00319971 predicted 902
9 SASI_Hs02_00319972 predicted 604
10 SASI_Hs02_00319973 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319974 predicted 603
2 SASI_Hs02_00319975 predicted 1207
3 SASI_Hs02_00319976 predicted 506
4 SASI_Hs02_00319977 predicted 1058
5 SASI_Hs02_00319978 predicted 676
6 SASI_Hs02_00319979 predicted 1067
7 SASI_Hs02_00319980 predicted 679
8 SASI_Hs02_00319981 predicted 908
9 SASI_Hs02_00319982 predicted 597
10 SASI_Hs02_00319983 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319984 predicted 526
2 SASI_Hs02_00319985 predicted 1134
3 SASI_Hs02_00319986 predicted 433
4 SASI_Hs02_00319987 predicted 993
5 SASI_Hs02_00319988 predicted 598
6 SASI_Hs02_00319989 predicted 992
7 SASI_Hs02_00319990 predicted 612
8 SASI_Hs02_00319991 predicted 837
9 SASI_Hs02_00319992 predicted 531
10 SASI_Hs02_00319993 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347084 predicted 601
2 SASI_Hs02_00347085 predicted 1210
3 SASI_Hs02_00347086 predicted 502
4 SASI_Hs02_00347087 predicted 1066
5 SASI_Hs02_00347088 predicted 673
6 SASI_Hs02_00347089 predicted 1060
7 SASI_Hs02_00347090 predicted 687
8 SASI_Hs02_00347091 predicted 904
9 SASI_Hs02_00347092 predicted 603
10 SASI_Hs02_00347093 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_034872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248338 predicted 1123
2 SASI_Hs01_00248339 predicted 1041
3 SASI_Hs01_00248340 predicted 1065
4 SASI_Hs01_00248341 predicted 1123
5 SASI_Hs01_00248342 predicted 927
6 SASI_Hs01_00248343 predicted 981
7 SASI_Hs01_00248344 predicted 1083
8 SASI_Hs01_00248345 predicted 1017
9 SASI_Hs01_00248346 predicted 1014
10 SASI_Hs01_00248347 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254798 predicted 1127
2 SASI_Hs01_00254799 predicted 1044
3 SASI_Hs01_00254800 predicted 1067
4 SASI_Hs01_00254801 predicted 1120
5 SASI_Hs01_00254802 predicted 922
6 SASI_Hs01_00254803 predicted 983
7 SASI_Hs01_00254804 predicted 1081
8 SASI_Hs01_00254805 predicted 1012
9 SASI_Hs01_00254806 predicted 1013
10 SASI_Hs01_00254807 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299943 predicted 269
2 SASI_Hs01_00299944 predicted 269
3 SASI_Hs01_00299945 predicted 253
4 SASI_Hs01_00299946 predicted 277
5 SASI_Hs01_00299947 predicted 254
6 SASI_Hs01_00299948 predicted 367
7 SASI_Hs01_00299949 predicted 187
8 SASI_Hs01_00299950 predicted 193
9 SASI_Hs01_00299951 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224516 predicted 564
2 SASI_Rn02_00224517 predicted 782
3 SASI_Rn02_00224518 predicted 389
4 SASI_Rn02_00224519 predicted 459
5 SASI_Rn02_00224520 predicted 633
6 SASI_Rn02_00224521 predicted 286
7 SASI_Rn02_00224522 predicted 1434
8 SASI_Rn02_00224523 predicted 1458
9 SASI_Rn02_00224524 predicted 1442
10 SASI_Rn02_00224525 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121208 predicted 877
2 SASI_Mm01_00121209 predicted 546
3 SASI_Mm01_00121210 predicted 347
4 SASI_Mm01_00121211 predicted 1969
5 SASI_Mm01_00121212 predicted 384
6 SASI_Mm01_00121213 predicted 730
7 SASI_Mm01_00121214 predicted 1888
8 SASI_Mm01_00121215 predicted 1981
9 SASI_Mm01_00121216 predicted 1956
10 SASI_Mm01_00121217 predicted 1316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033144
SEPT8 MISSION shRNA Bacterial Glycerol Stock
septin 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-550s21c1
Sequence:CCGGGATGACAGTTACAGGCCCATACTCGAGTATGGGCCTGTAACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033144.1-3977s21c1
Sequence:CCGGCCGTGTAAGTTATGGTCTAAACTCGAGTTTAGACCATAACTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-387s21c1
Sequence:CCGGGCTAATGAACACACTCTTCAACTCGAGTTGAAGAGTGTGTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-882s21c1
Sequence:CCGGCGCCGAGATTAATGCAGTCATCTCGAGATGACTGCATTAATCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-387s1c1
Sequence:CCGGGCTAATGAACACACTCTTCAACTCGAGTTGAAGAGTGTGTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-550s1c1
Sequence:CCGGGATGACAGTTACAGGCCCATACTCGAGTATGGGCCTGTAACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-882s1c1
Sequence:CCGGCGCCGAGATTAATGCAGTCATCTCGAGATGACTGCATTAATCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033144.1-3977s1c1
Sequence:CCGGCCGTGTAAGTTATGGTCTAAACTCGAGTTTAGACCATAACTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-384s1c1
Sequence:CCGGCACGCTAATGAACACACTCTTCTCGAGAAGAGTGTGTTCATTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033144
SEPT8 MISSION shRNA shRNA Plasmid DNA
septin 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-550s21c1
Sequence:CCGGGATGACAGTTACAGGCCCATACTCGAGTATGGGCCTGTAACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033144.1-3977s21c1
Sequence:CCGGCCGTGTAAGTTATGGTCTAAACTCGAGTTTAGACCATAACTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-387s21c1
Sequence:CCGGGCTAATGAACACACTCTTCAACTCGAGTTGAAGAGTGTGTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-882s21c1
Sequence:CCGGCGCCGAGATTAATGCAGTCATCTCGAGATGACTGCATTAATCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-387s1c1
Sequence:CCGGGCTAATGAACACACTCTTCAACTCGAGTTGAAGAGTGTGTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-550s1c1
Sequence:CCGGGATGACAGTTACAGGCCCATACTCGAGTATGGGCCTGTAACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-882s1c1
Sequence:CCGGCGCCGAGATTAATGCAGTCATCTCGAGATGACTGCATTAATCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033144.1-3977s1c1
Sequence:CCGGCCGTGTAAGTTATGGTCTAAACTCGAGTTTAGACCATAACTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-384s1c1
Sequence:CCGGCACGCTAATGAACACACTCTTCTCGAGAAGAGTGTGTTCATTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033144
SEPT8 MISSION shRNA Lentiviral Transduction Particles
septin 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-550s21c1
Sequence:CCGGGATGACAGTTACAGGCCCATACTCGAGTATGGGCCTGTAACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033144.1-3977s21c1
Sequence:CCGGCCGTGTAAGTTATGGTCTAAACTCGAGTTTAGACCATAACTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-387s21c1
Sequence:CCGGGCTAATGAACACACTCTTCAACTCGAGTTGAAGAGTGTGTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033144.1-882s21c1
Sequence:CCGGCGCCGAGATTAATGCAGTCATCTCGAGATGACTGCATTAATCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-387s1c1
Sequence:CCGGGCTAATGAACACACTCTTCAACTCGAGTTGAAGAGTGTGTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-550s1c1
Sequence:CCGGGATGACAGTTACAGGCCCATACTCGAGTATGGGCCTGTAACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-882s1c1
Sequence:CCGGCGCCGAGATTAATGCAGTCATCTCGAGATGACTGCATTAATCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033144.1-3977s1c1
Sequence:CCGGCCGTGTAAGTTATGGTCTAAACTCGAGTTTAGACCATAACTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033144.1-384s1c1
Sequence:CCGGCACGCTAATGAACACACTCTTCTCGAGAAGAGTGTGTTCATTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098811
VALIDATED
SEPT8 MISSION shRNA Bacterial Glycerol Stock
septin 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098811.1-1516s21c1
Sequence:CCGGCAAGAAGAACAGATCAGATATCTCGAGATATCTGATCTGTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-569s21c1
Sequence:CCGGATCAATAAGGATGAGAGTTACCTCGAGGTAACTCTCATCCTTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-915s21c1
Sequence:CCGGAGATTAACGCAGTCATGAATGCTCGAGCATTCATGACTGCGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-1416s21c1
Sequence:CCGGAGGAGACCAACGCCTTCAATCCTCGAGGATTGAAGGCGTTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098811.1-2060s21c1
Sequence:CCGGACTTGTATCTGCTTATCATAACTCGAGTTATGATAAGCAGATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098811
VALIDATED
SEPT8 MISSION shRNA shRNA Plasmid DNA
septin 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098811.1-1516s21c1
Sequence:CCGGCAAGAAGAACAGATCAGATATCTCGAGATATCTGATCTGTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-569s21c1
Sequence:CCGGATCAATAAGGATGAGAGTTACCTCGAGGTAACTCTCATCCTTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-915s21c1
Sequence:CCGGAGATTAACGCAGTCATGAATGCTCGAGCATTCATGACTGCGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-1416s21c1
Sequence:CCGGAGGAGACCAACGCCTTCAATCCTCGAGGATTGAAGGCGTTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098811.1-2060s21c1
Sequence:CCGGACTTGTATCTGCTTATCATAACTCGAGTTATGATAAGCAGATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098811
VALIDATED
SEPT8 MISSION shRNA Lentiviral Transduction Particles
septin 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098811.1-1516s21c1
Sequence:CCGGCAAGAAGAACAGATCAGATATCTCGAGATATCTGATCTGTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-569s21c1
Sequence:CCGGATCAATAAGGATGAGAGTTACCTCGAGGTAACTCTCATCCTTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-915s21c1
Sequence:CCGGAGATTAACGCAGTCATGAATGCTCGAGCATTCATGACTGCGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098811.1-1416s21c1
Sequence:CCGGAGGAGACCAACGCCTTCAATCCTCGAGGATTGAAGGCGTTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098811.1-2060s21c1
Sequence:CCGGACTTGTATCTGCTTATCATAACTCGAGTTATGATAAGCAGATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks