EMAIL THIS PAGE TO A FRIEND

SERINC4

serine incorporator 4

UniProtKB ID: A6NH21, B2RN41, Q3YL75
Gene ID:
Mouse(574418) serine incorporator 4
Rat(311358) serine incorporator 4
Domestic Rabbit(100328688) serine incorporator 4
naked mole-rat(101722385) serine incorporator 4
domestic guinea pig(101787310) serine incorporator 4
cow(512649) serine incorporator 4
sheep(101110971) serine incorporator 4
chicken(430755) serine incorporator 4
domestic cat(101099886) serine incorporator 4
Horse(100070743) serine incorporator 4
dog(487527) serine incorporator 4
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001033517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033517 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123991 MISSION® esiRNA esiRNA human SERINC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033517 Rosetta Predictions human pricing
NM_001110811 Rosetta Predictions rat pricing
NM_001025371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244364 predicted 900
2 SASI_Hs02_00308033 predicted 767
3 SASI_Hs01_00244367 predicted 896
4 SASI_Hs01_00244368 predicted 691
5 SASI_Hs01_00244369 predicted 831
6 SASI_Hs02_00308034 predicted 834
7 SASI_Hs01_00244372 predicted 1002
8 SASI_Hs01_00244373 predicted 828
9 SASI_Hs02_00308035 predicted 670
10 SASI_Hs02_00308036 predicted 926
11 SASI_Hs01_00244365 predicted 1200
12 SASI_Hs01_00244366 predicted 1159
13 SASI_Hs01_00244370 predicted 1210
14 SASI_Hs01_00244371 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251372 predicted 1661
2 SASI_Rn02_00251373 predicted 475
3 SASI_Rn02_00251374 predicted 886
4 SASI_Rn02_00251375 predicted 1605
5 SASI_Rn02_00251376 predicted 872
6 SASI_Rn02_00251377 predicted 525
7 SASI_Rn02_00251378 predicted 1058
8 SASI_Rn02_00251379 predicted 1078
9 SASI_Rn02_00251380 predicted 1193
10 SASI_Rn02_00251381 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061705 predicted 1296
2 SASI_Mm01_00061706 predicted 1684
3 SASI_Mm01_00061707 predicted 1671
4 SASI_Mm01_00061708 predicted 1231
5 SASI_Mm01_00061709 predicted 1127
6 SASI_Mm01_00061710 predicted 1214
7 SASI_Mm01_00061711 predicted 1709
8 SASI_Mm01_00061712 predicted 1061
9 SASI_Mm01_00061713 predicted 273
10 SASI_Mm01_00061714 predicted 1496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025371
SERINC4 MISSION shRNA Bacterial Glycerol Stock
serine incorporator 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-266s21c1
Sequence:CCGGCAGCACGGTGGAGTCAGTAATCTCGAGATTACTGACTCCACCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-762s21c1
Sequence:CCGGGCTTCACATTCATCCTATTACCTCGAGGTAATAGGATGAATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-1166s21c1
Sequence:CCGGTGTCTGCCTGGCCGGAATAAACTCGAGTTTATTCCGGCCAGGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-726s21c1
Sequence:CCGGTCTTCCCAGCCTGGCATTATACTCGAGTATAATGCCAGGCTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025371.1-1057s1c1
Sequence:CCGGCCTCCTACAAGCCTCTATCATCTCGAGATGATAGAGGCTTGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025371
SERINC4 MISSION shRNA shRNA Plasmid DNA
serine incorporator 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-266s21c1
Sequence:CCGGCAGCACGGTGGAGTCAGTAATCTCGAGATTACTGACTCCACCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-762s21c1
Sequence:CCGGGCTTCACATTCATCCTATTACCTCGAGGTAATAGGATGAATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-1166s21c1
Sequence:CCGGTGTCTGCCTGGCCGGAATAAACTCGAGTTTATTCCGGCCAGGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-726s21c1
Sequence:CCGGTCTTCCCAGCCTGGCATTATACTCGAGTATAATGCCAGGCTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025371.1-1057s1c1
Sequence:CCGGCCTCCTACAAGCCTCTATCATCTCGAGATGATAGAGGCTTGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025371
SERINC4 MISSION shRNA Lentiviral Transduction Particles
serine incorporator 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-266s21c1
Sequence:CCGGCAGCACGGTGGAGTCAGTAATCTCGAGATTACTGACTCCACCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-762s21c1
Sequence:CCGGGCTTCACATTCATCCTATTACCTCGAGGTAATAGGATGAATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-1166s21c1
Sequence:CCGGTGTCTGCCTGGCCGGAATAAACTCGAGTTTATTCCGGCCAGGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025371.1-726s21c1
Sequence:CCGGTCTTCCCAGCCTGGCATTATACTCGAGTATAATGCCAGGCTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025371.1-1057s1c1
Sequence:CCGGCCTCCTACAAGCCTCTATCATCTCGAGATGATAGAGGCTTGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033517
SERINC4 MISSION shRNA Bacterial Glycerol Stock
serine incorporator 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000220073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-693s1c1
Sequence:CCGGTACTGCAGTTGGTGCTTATTACTCGAGTAATAAGCACCAACTGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1004s1c1
Sequence:CCGGCCTGTGGATTGTCAAGGTTTACTCGAGTAAACCTTGACAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1154s1c1
Sequence:CCGGCCAGCATCTTTCCTACAACTACTCGAGTAGTTGTAGGAAAGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1203s1c1
Sequence:CCGGGCCTCACTCTATGTCATGGTTCTCGAGAACCATGACATAGAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-926s1c1
Sequence:CCGGGCTGAGTGCTAGCATCATGTACTCGAGTACATGATGCTAGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033517
SERINC4 MISSION shRNA shRNA Plasmid DNA
serine incorporator 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000220073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-693s1c1
Sequence:CCGGTACTGCAGTTGGTGCTTATTACTCGAGTAATAAGCACCAACTGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1004s1c1
Sequence:CCGGCCTGTGGATTGTCAAGGTTTACTCGAGTAAACCTTGACAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1154s1c1
Sequence:CCGGCCAGCATCTTTCCTACAACTACTCGAGTAGTTGTAGGAAAGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1203s1c1
Sequence:CCGGGCCTCACTCTATGTCATGGTTCTCGAGAACCATGACATAGAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-926s1c1
Sequence:CCGGGCTGAGTGCTAGCATCATGTACTCGAGTACATGATGCTAGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033517
SERINC4 MISSION shRNA Lentiviral Transduction Particles
serine incorporator 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000220073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-693s1c1
Sequence:CCGGTACTGCAGTTGGTGCTTATTACTCGAGTAATAAGCACCAACTGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1004s1c1
Sequence:CCGGCCTGTGGATTGTCAAGGTTTACTCGAGTAAACCTTGACAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1154s1c1
Sequence:CCGGCCAGCATCTTTCCTACAACTACTCGAGTAGTTGTAGGAAAGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-1203s1c1
Sequence:CCGGGCCTCACTCTATGTCATGGTTCTCGAGAACCATGACATAGAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033517.1-926s1c1
Sequence:CCGGGCTGAGTGCTAGCATCATGTACTCGAGTACATGATGCTAGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks