EMAIL THIS PAGE TO A FRIEND

SERINC5

serine incorporator 5

Synonyms: C5orf12 TPO1
UniProtKB ID: Q86VE9, B4DMH7, Q495A4, Q495A6
Gene ID:
Mouse(218442) serine incorporator 5
Rat(170907) serine incorporator 5
Zebrafish(406835) serine incorporator 5
chicken(427175) serine incorporator 5
dog(479168) serine incorporator 5
domestic cat(101089919) serine incorporator 5
cow(504658) serine incorporator 5
sheep(101109361) serine incorporator 5
domestic guinea pig(100730874) serine incorporator 5
naked mole-rat(101697204) serine incorporator 5
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143031 MISSION® esiRNA esiRNA human SERINC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178276 Rosetta Predictions human pricing
NM_133395 Rosetta Predictions rat pricing
NM_172588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034239 predicted 1082
2 SASI_Hs01_00034242 predicted 1007
3 SASI_Hs01_00034243 predicted 864
4 SASI_Hs01_00034244 predicted 688
5 SASI_Hs01_00034245 predicted 304
6 SASI_Hs01_00034246 predicted 387
7 SASI_Hs01_00034247 predicted 792
8 SASI_Hs01_00034248 predicted 918
9 SASI_Hs02_00369627 predicted 656
10 SASI_Hs02_00369628 predicted 471
11 SASI_Hs01_00034240 predicted 1094
12 SASI_Hs01_00034241 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267652 predicted 1050
2 SASI_Rn01_00118946 predicted 1309
3 SASI_Rn01_00118947 predicted 568
4 SASI_Rn01_00118948 predicted 1319
5 SASI_Rn01_00118949 predicted 393
6 SASI_Rn01_00118950 predicted 413
7 SASI_Rn01_00118951 predicted 1106
8 SASI_Rn01_00118952 predicted 667
9 SASI_Rn01_00118953 predicted 945
10 SASI_Rn01_00118954 predicted 1035
11 SASI_Rn01_00118955 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094172 predicted 1636
2 SASI_Mm01_00094173 predicted 1727
3 SASI_Mm01_00094174 predicted 1709
4 SASI_Mm01_00094175 predicted 1673
5 SASI_Mm01_00094176 predicted 1280
6 SASI_Mm01_00094177 predicted 1293
7 SASI_Mm01_00094178 predicted 731
8 SASI_Mm02_00344269 predicted 1189
9 SASI_Mm01_00094179 predicted 483
10 SASI_Mm02_00344270 predicted 366
11 SASI_Mm01_00094180 predicted 1568
12 SASI_Mm01_00094181 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178276
SERINC5 MISSION shRNA Bacterial Glycerol Stock
serine incorporator 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1285s1c1
Sequence:CCGGCACCGTCTACATCTACTCCTACTCGAGTAGGAGTAGATGTAGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-396s1c1
Sequence:CCGGCTGCCGTGTATAGAGTCTGTTCTCGAGAACAGACTCTATACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1083s1c1
Sequence:CCGGCCAGCCTCTTAATCGGATGTACTCGAGTACATCCGATTAAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178276.2-1538s1c1
Sequence:CCGGGCACATCAAAGAATGCAATTACTCGAGTAATTGCATTCTTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-853s1c1
Sequence:CCGGGCTTATATCATTGGTAGCCATCTCGAGATGGCTACCAATGATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178276.2-1419s1c1
Sequence:CCGGGCCATGTGGAACTCTGAGAAACTCGAGTTTCTCAGAGTTCCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1166s1c1
Sequence:CCGGGCAGCTCCTGAATTGGAGATACTCGAGTATCTCCAATTCAGGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-299s21c1
Sequence:CCGGCCGTGGCTCACAAGATGAAAGCTCGAGCTTTCATCTTGTGAGCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-1249s21c1
Sequence:CCGGGAGGGACCACGGGTCATTTATCTCGAGATAAATGACCCGTGGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-482s21c1
Sequence:CCGGGTAGAGCTCATATTCACAATGCTCGAGCATTGTGAATATGAGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178276
SERINC5 MISSION shRNA shRNA Plasmid DNA
serine incorporator 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1285s1c1
Sequence:CCGGCACCGTCTACATCTACTCCTACTCGAGTAGGAGTAGATGTAGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-396s1c1
Sequence:CCGGCTGCCGTGTATAGAGTCTGTTCTCGAGAACAGACTCTATACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1083s1c1
Sequence:CCGGCCAGCCTCTTAATCGGATGTACTCGAGTACATCCGATTAAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178276.2-1538s1c1
Sequence:CCGGGCACATCAAAGAATGCAATTACTCGAGTAATTGCATTCTTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-853s1c1
Sequence:CCGGGCTTATATCATTGGTAGCCATCTCGAGATGGCTACCAATGATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178276.2-1419s1c1
Sequence:CCGGGCCATGTGGAACTCTGAGAAACTCGAGTTTCTCAGAGTTCCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1166s1c1
Sequence:CCGGGCAGCTCCTGAATTGGAGATACTCGAGTATCTCCAATTCAGGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-299s21c1
Sequence:CCGGCCGTGGCTCACAAGATGAAAGCTCGAGCTTTCATCTTGTGAGCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-1249s21c1
Sequence:CCGGGAGGGACCACGGGTCATTTATCTCGAGATAAATGACCCGTGGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-482s21c1
Sequence:CCGGGTAGAGCTCATATTCACAATGCTCGAGCATTGTGAATATGAGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178276
SERINC5 MISSION shRNA Lentiviral Transduction Particles
serine incorporator 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1285s1c1
Sequence:CCGGCACCGTCTACATCTACTCCTACTCGAGTAGGAGTAGATGTAGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-396s1c1
Sequence:CCGGCTGCCGTGTATAGAGTCTGTTCTCGAGAACAGACTCTATACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1083s1c1
Sequence:CCGGCCAGCCTCTTAATCGGATGTACTCGAGTACATCCGATTAAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178276.2-1538s1c1
Sequence:CCGGGCACATCAAAGAATGCAATTACTCGAGTAATTGCATTCTTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-853s1c1
Sequence:CCGGGCTTATATCATTGGTAGCCATCTCGAGATGGCTACCAATGATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178276.2-1419s1c1
Sequence:CCGGGCCATGTGGAACTCTGAGAAACTCGAGTTTCTCAGAGTTCCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178276.2-1166s1c1
Sequence:CCGGGCAGCTCCTGAATTGGAGATACTCGAGTATCTCCAATTCAGGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-299s21c1
Sequence:CCGGCCGTGGCTCACAAGATGAAAGCTCGAGCTTTCATCTTGTGAGCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-1249s21c1
Sequence:CCGGGAGGGACCACGGGTCATTTATCTCGAGATAAATGACCCGTGGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178276.4-482s21c1
Sequence:CCGGGTAGAGCTCATATTCACAATGCTCGAGCATTGTGAATATGAGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172588
VALIDATED
SERINC5 MISSION shRNA Bacterial Glycerol Stock
serine incorporator 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-1785s1c1
Sequence:CCGGCCCAAGAATTAGCTGAAGTTTCTCGAGAAACTTCAGCTAATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172588.2-690s1c1
Sequence:CCGGCGTCCGTAATAAGCTGTGGTACTCGAGTACCACAGCTTATTACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-228s1c1
Sequence:CCGGCCGCTTCATGTATTTATTCTACTCGAGTAGAATAAATACATGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172588.2-1080s1c1
Sequence:CCGGCCTTCTTCTAATTGTGTGCATCTCGAGATGCACACAATTAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-651s1c1
Sequence:CCGGGTTTGCACATAAGTGGAACAACTCGAGTTGTTCCACTTATGTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172588
VALIDATED
SERINC5 MISSION shRNA shRNA Plasmid DNA
serine incorporator 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-1785s1c1
Sequence:CCGGCCCAAGAATTAGCTGAAGTTTCTCGAGAAACTTCAGCTAATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172588.2-690s1c1
Sequence:CCGGCGTCCGTAATAAGCTGTGGTACTCGAGTACCACAGCTTATTACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-228s1c1
Sequence:CCGGCCGCTTCATGTATTTATTCTACTCGAGTAGAATAAATACATGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172588.2-1080s1c1
Sequence:CCGGCCTTCTTCTAATTGTGTGCATCTCGAGATGCACACAATTAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-651s1c1
Sequence:CCGGGTTTGCACATAAGTGGAACAACTCGAGTTGTTCCACTTATGTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172588
VALIDATED
SERINC5 MISSION shRNA Lentiviral Transduction Particles
serine incorporator 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-1785s1c1
Sequence:CCGGCCCAAGAATTAGCTGAAGTTTCTCGAGAAACTTCAGCTAATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172588.2-690s1c1
Sequence:CCGGCGTCCGTAATAAGCTGTGGTACTCGAGTACCACAGCTTATTACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-228s1c1
Sequence:CCGGCCGCTTCATGTATTTATTCTACTCGAGTAGAATAAATACATGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172588.2-1080s1c1
Sequence:CCGGCCTTCTTCTAATTGTGTGCATCTCGAGATGCACACAATTAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172588.2-651s1c1
Sequence:CCGGGTTTGCACATAAGTGGAACAACTCGAGTTGTTCCACTTATGTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks