EMAIL THIS PAGE TO A FRIEND

SERPINA10

serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10

Synonyms: PZI ZPI
UniProtKB ID: Q9UK55, A5Z2A5, Q6UWX9, Q86U20
Gene ID:
Human(51156) Summary: The protein encoded by this gene belongs to the serpin family. It is predominantly expressed in the liver and secreted in plasma. It inhibits the activity of coagulation factors Xa and XIa in the presence of protein Z, calcium and phospholipid. Mutations in this gene are associated with venous thrombosis. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, May 2010]
Mouse(217847) serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Rat(171154) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
cow(517172) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
sheep(101117968) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
domestic guinea pig(100734118) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
naked mole-rat(101710127) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
chicken(423432) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100607 Rosetta Predictions human pricing
NM_016186 Rosetta Predictions human pricing
NM_133617 Rosetta Predictions rat pricing
NM_144834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322244 predicted 904
2 SASI_Hs02_00322245 predicted 779
3 SASI_Hs02_00322246 predicted 784
4 SASI_Hs02_00322247 predicted 631
5 SASI_Hs02_00322248 predicted 1162
6 SASI_Hs02_00322249 predicted 861
7 SASI_Hs02_00322250 predicted 810
8 SASI_Hs02_00322251 predicted 365
9 SASI_Hs02_00322252 predicted 936
10 SASI_Hs02_00322253 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032749 predicted 1247
2 SASI_Hs01_00032750 predicted 1129
3 SASI_Hs02_00349017 predicted 1129
4 SASI_Hs01_00032751 predicted 985
5 SASI_Hs01_00032752 predicted 1507
6 SASI_Hs02_00349018 predicted 1207
7 SASI_Hs01_00032754 predicted 1157
8 SASI_Hs01_00032755 predicted 705
9 SASI_Hs01_00032756 predicted 1282
10 SASI_Hs01_00032757 predicted 982
11 SASI_Hs01_00032753 predicted 1283
12 SASI_Hs01_00032758 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267842 predicted 919
2 SASI_Rn01_00116353 predicted 451
3 SASI_Rn01_00116354 predicted 631
4 SASI_Rn01_00116355 predicted 704
5 SASI_Rn01_00116356 predicted 582
6 SASI_Rn01_00116357 predicted 889
7 SASI_Rn01_00116358 predicted 327
8 SASI_Rn01_00116359 predicted 1161
9 SASI_Rn01_00116360 predicted 1308
10 SASI_Rn01_00116361 predicted 1058
11 SASI_Rn01_00116362 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107106 predicted 1273
2 SASI_Mm01_00107107 predicted 735
3 SASI_Mm01_00107109 predicted 1096
4 SASI_Mm01_00107110 predicted 551
5 SASI_Mm01_00107111 predicted 962
6 SASI_Mm01_00107112 predicted 851
7 SASI_Mm01_00107114 predicted 1200
8 SASI_Mm01_00107115 predicted 1268
9 SASI_Mm02_00340223 predicted 628
10 SASI_Mm02_00340224 predicted 672
11 SASI_Mm01_00107108 predicted 601
12 SASI_Mm01_00107113 predicted 890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016186
SERPINA10 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016186.2-2003s21c1
Sequence:CCGGTGGACAGTGCTGAACCTTATACTCGAGTATAAGGTTCAGCACTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016186.2-1241s21c1
Sequence:CCGGGACAAGTACAAGACCATTAAGCTCGAGCTTAATGGTCTTGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016186.2-1214s21c1
Sequence:CCGGTTCACCGAAGTCGACACTTTCCTCGAGGAAAGTGTCGACTTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1661s1c1
Sequence:CCGGGCAGGAATCTTGTCAGAAATTCTCGAGAATTTCTGACAAGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1118s1c1
Sequence:CCGGCCCAAACTGTTTGATGAGATTCTCGAGAATCTCATCAAACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1293s1c1
Sequence:CCGGCCTCCACCTTTGACAAGAATTCTCGAGAATTCTTGTCAAAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-820s1c1
Sequence:CCGGGCCGACTGAAACCCAGATCAACTCGAGTTGATCTGGGTTTCAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-688s1c1
Sequence:CCGGGCTTGCCAAGGAGACTTCAAACTCGAGTTTGAAGTCTCCTTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016186
SERPINA10 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016186.2-2003s21c1
Sequence:CCGGTGGACAGTGCTGAACCTTATACTCGAGTATAAGGTTCAGCACTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016186.2-1241s21c1
Sequence:CCGGGACAAGTACAAGACCATTAAGCTCGAGCTTAATGGTCTTGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016186.2-1214s21c1
Sequence:CCGGTTCACCGAAGTCGACACTTTCCTCGAGGAAAGTGTCGACTTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1661s1c1
Sequence:CCGGGCAGGAATCTTGTCAGAAATTCTCGAGAATTTCTGACAAGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1118s1c1
Sequence:CCGGCCCAAACTGTTTGATGAGATTCTCGAGAATCTCATCAAACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1293s1c1
Sequence:CCGGCCTCCACCTTTGACAAGAATTCTCGAGAATTCTTGTCAAAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-820s1c1
Sequence:CCGGGCCGACTGAAACCCAGATCAACTCGAGTTGATCTGGGTTTCAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-688s1c1
Sequence:CCGGGCTTGCCAAGGAGACTTCAAACTCGAGTTTGAAGTCTCCTTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016186
SERPINA10 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016186.2-2003s21c1
Sequence:CCGGTGGACAGTGCTGAACCTTATACTCGAGTATAAGGTTCAGCACTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016186.2-1241s21c1
Sequence:CCGGGACAAGTACAAGACCATTAAGCTCGAGCTTAATGGTCTTGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016186.2-1214s21c1
Sequence:CCGGTTCACCGAAGTCGACACTTTCCTCGAGGAAAGTGTCGACTTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1661s1c1
Sequence:CCGGGCAGGAATCTTGTCAGAAATTCTCGAGAATTTCTGACAAGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1118s1c1
Sequence:CCGGCCCAAACTGTTTGATGAGATTCTCGAGAATCTCATCAAACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-1293s1c1
Sequence:CCGGCCTCCACCTTTGACAAGAATTCTCGAGAATTCTTGTCAAAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-820s1c1
Sequence:CCGGGCCGACTGAAACCCAGATCAACTCGAGTTGATCTGGGTTTCAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016186.1-688s1c1
Sequence:CCGGGCTTGCCAAGGAGACTTCAAACTCGAGTTTGAAGTCTCCTTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144834
SERPINA10 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-172s1c1
Sequence:CCGGCTCAGGATTATGAGAATCAAACTCGAGTTTGATTCTCATAATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1277s1c1
Sequence:CCGGGCTGTCAGAGATTATCGCTTACTCGAGTAAGCGATAATCTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-361s1c1
Sequence:CCGGGCAATGTGATCTTCTCACCTTCTCGAGAAGGTGAGAAGATCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1276s1c1
Sequence:CCGGCGCTGTCAGAGATTATCGCTTCTCGAGAAGCGATAATCTCTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1124s1c1
Sequence:CCGGGCTGCTCAAACAGATGGGAATCTCGAGATTCCCATCTGTTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144834
SERPINA10 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-172s1c1
Sequence:CCGGCTCAGGATTATGAGAATCAAACTCGAGTTTGATTCTCATAATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1277s1c1
Sequence:CCGGGCTGTCAGAGATTATCGCTTACTCGAGTAAGCGATAATCTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-361s1c1
Sequence:CCGGGCAATGTGATCTTCTCACCTTCTCGAGAAGGTGAGAAGATCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1276s1c1
Sequence:CCGGCGCTGTCAGAGATTATCGCTTCTCGAGAAGCGATAATCTCTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1124s1c1
Sequence:CCGGGCTGCTCAAACAGATGGGAATCTCGAGATTCCCATCTGTTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144834
SERPINA10 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-172s1c1
Sequence:CCGGCTCAGGATTATGAGAATCAAACTCGAGTTTGATTCTCATAATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1277s1c1
Sequence:CCGGGCTGTCAGAGATTATCGCTTACTCGAGTAAGCGATAATCTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-361s1c1
Sequence:CCGGGCAATGTGATCTTCTCACCTTCTCGAGAAGGTGAGAAGATCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1276s1c1
Sequence:CCGGCGCTGTCAGAGATTATCGCTTCTCGAGAAGCGATAATCTCTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144834.2-1124s1c1
Sequence:CCGGGCTGCTCAAACAGATGGGAATCTCGAGATTCCCATCTGTTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks