EMAIL THIS PAGE TO A FRIEND

SERPINA2P

serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2, pseudogene

Synonyms: ARGS ATR PIL SERPINA2 psiATR
Species: Human SERPINA2P(390502)
UniProtKB ID: P20848
Gene ID:
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372532 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_372532 Rosetta Predictions human pricing
XR_041181 Rosetta Predictions human pricing
XR_041182 Rosetta Predictions human pricing
XR_041183 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254527 predicted 930
2 SASI_Hs01_00254528 predicted 1124
3 SASI_Hs01_00254529 predicted 437
4 SASI_Hs01_00254530 predicted 680
5 SASI_Hs01_00254531 predicted 1504
6 SASI_Hs01_00254532 predicted 971
7 SASI_Hs01_00254533 predicted 1454
8 SASI_Hs01_00254534 predicted 1030
9 SASI_Hs01_00254535 predicted 695
10 SASI_Hs01_00254536 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525302 predicted 1052
2 SASI_Hs02_00525303 predicted 860
3 SASI_Hs02_00525304 predicted 755
4 SASI_Hs02_00525305 predicted 820
5 SASI_Hs02_00525306 predicted 439
6 SASI_Hs02_00525307 predicted 1102
7 SASI_Hs02_00525308 predicted 589
8 SASI_Hs02_00525309 predicted 490
9 SASI_Hs02_00525310 predicted 334
10 SASI_Hs02_00525311 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525312 predicted 428
2 SASI_Hs02_00525313 predicted 826
3 SASI_Hs02_00525314 predicted 437
4 SASI_Hs02_00525315 predicted 272
5 SASI_Hs02_00525316 predicted 282
6 SASI_Hs02_00525317 predicted 771
7 SASI_Hs02_00525318 predicted 343
8 SASI_Hs02_00525319 predicted 678
9 SASI_Hs02_00525320 predicted 495
10 SASI_Hs02_00525321 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525322 predicted 389
2 SASI_Hs02_00525323 predicted 790
3 SASI_Hs02_00525324 predicted 404
4 SASI_Hs02_00525325 predicted 244
5 SASI_Hs02_00525326 predicted 246
6 SASI_Hs02_00525327 predicted 738
7 SASI_Hs02_00525328 predicted 309
8 SASI_Hs02_00525329 predicted 644
9 SASI_Hs02_00525330 predicted 458
10 SASI_Hs02_00525331 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372532
SERPINA2P MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-462s1c1
Sequence:CCGGCCTGTTTGTTAACAAGAGTATCTCGAGATACTCTTGTTAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-777s1c1
Sequence:CCGGCCACCTGGGTAGATTTGACATCTCGAGATGTCAAATCTACCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-207s1c1
Sequence:CCGGCCTCGCCTTTGATTTGTACAACTCGAGTTGTACAAATCAAAGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-175s1c1
Sequence:CCGGGCTTGCCAGAAGATCTCCTATCTCGAGATAGGAGATCTTCTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-660s1c1
Sequence:CCGGCCTGGTGGATTACATTTCCTTCTCGAGAAGGAAATGTAATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372532
SERPINA2P MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-462s1c1
Sequence:CCGGCCTGTTTGTTAACAAGAGTATCTCGAGATACTCTTGTTAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-777s1c1
Sequence:CCGGCCACCTGGGTAGATTTGACATCTCGAGATGTCAAATCTACCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-207s1c1
Sequence:CCGGCCTCGCCTTTGATTTGTACAACTCGAGTTGTACAAATCAAAGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-175s1c1
Sequence:CCGGGCTTGCCAGAAGATCTCCTATCTCGAGATAGGAGATCTTCTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-660s1c1
Sequence:CCGGCCTGGTGGATTACATTTCCTTCTCGAGAAGGAAATGTAATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372532
SERPINA2P MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-462s1c1
Sequence:CCGGCCTGTTTGTTAACAAGAGTATCTCGAGATACTCTTGTTAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-777s1c1
Sequence:CCGGCCACCTGGGTAGATTTGACATCTCGAGATGTCAAATCTACCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-207s1c1
Sequence:CCGGCCTCGCCTTTGATTTGTACAACTCGAGTTGTACAAATCAAAGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-175s1c1
Sequence:CCGGGCTTGCCAGAAGATCTCCTATCTCGAGATAGGAGATCTTCTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372532.1-660s1c1
Sequence:CCGGCCTGGTGGATTACATTTCCTTCTCGAGAAGGAAATGTAATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks