EMAIL THIS PAGE TO A FRIEND

SERPINB6

serpin peptidase inhibitor, clade B (ovalbumin), member 6

Synonyms: CAP DFNB91 MSTP057 PI-6 PI6 PTI SPI3
Gene ID:
Human(5269) Summary: The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
Rat(291085) serpin peptidase inhibitor, clade B (ovalbumin), member 6
chicken(420895) serpin peptidase inhibitor, clade B (ovalbumin), member 6
domestic cat(101085886) serpin peptidase inhibitor, clade B (ovalbumin), member 6
dog(478699) serpin peptidase inhibitor, clade B (ovalbumin), member 6
cow(286854) serpin peptidase inhibitor, clade B (ovalbumin), member 6
naked mole-rat(101699552) serpin peptidase inhibitor, clade B (ovalbumin), member 6
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004568 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087001 MISSION® esiRNA esiRNA human SERPINB6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004568 Rosetta Predictions human pricing
NM_199085 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217372 predicted 1001
2 SASI_Hs01_00217373 predicted 1000
3 SASI_Hs01_00217375 predicted 1114
4 SASI_Hs01_00217377 predicted 1189
5 SASI_Hs02_00337896 predicted 1113
6 SASI_Hs02_00337897 predicted 1085
7 SASI_Hs01_00217378 predicted 520
8 SASI_Hs02_00337898 predicted 921
9 SASI_Hs01_00217379 predicted 668
10 SASI_Hs01_00217380 predicted 533
11 SASI_Hs01_00217374 predicted 391
12 SASI_Hs01_00217376 predicted 878
13 SASI_Hs01_00217381 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055188 predicted 733
2 SASI_Rn01_00055189 predicted 852
3 SASI_Rn01_00055190 predicted 1126
4 SASI_Rn01_00055191 predicted 734
5 SASI_Rn01_00055192 predicted 696
6 SASI_Rn01_00055193 predicted 1048
7 SASI_Rn01_00055194 predicted 625
8 SASI_Rn01_00055195 predicted 571
9 SASI_Rn01_00055196 predicted 247
10 SASI_Rn01_00055197 predicted 1069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004568
VALIDATED
SERPINB6 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade B (ovalbumin), member 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-1391s21c1
Sequence:CCGGATGATGCGGTGTGCCAGATTCCTCGAGGAATCTGGCACACCGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-1025s21c1
Sequence:CCGGCAAATCTTGGTGCTTCCATATCTCGAGATATGGAAGCACCAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-962s21c1
Sequence:CCGGCCTGTGCAAATGATGTTTAAGCTCGAGCTTAAACATCATTTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-536s21c1
Sequence:CCGGGCCCAGATACTTTCTTTCAATCTCGAGATTGAAAGAAAGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-536s1c1
Sequence:CCGGGCCCAGATACTTTCTTTCAATCTCGAGATTGAAAGAAAGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004568.4-1025s1c1
Sequence:CCGGCAAATCTTGGTGCTTCCATATCTCGAGATATGGAAGCACCAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004568.4-1190s1c1
Sequence:CCGGCCGCGGTTTAAACTAGAGGAACTCGAGTTCCTCTAGTTTAAACCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-737s1c1
Sequence:CCGGCTTGACTTTATCAGCGCCGTACTCGAGTACGGCGCTGATAAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-430s1c1
Sequence:CCGGGCTGGGTAAAGACAACTCGAACTCGAGTTCGAGTTGTCTTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004568
VALIDATED
SERPINB6 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade B (ovalbumin), member 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-1391s21c1
Sequence:CCGGATGATGCGGTGTGCCAGATTCCTCGAGGAATCTGGCACACCGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-1025s21c1
Sequence:CCGGCAAATCTTGGTGCTTCCATATCTCGAGATATGGAAGCACCAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-962s21c1
Sequence:CCGGCCTGTGCAAATGATGTTTAAGCTCGAGCTTAAACATCATTTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-536s21c1
Sequence:CCGGGCCCAGATACTTTCTTTCAATCTCGAGATTGAAAGAAAGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-536s1c1
Sequence:CCGGGCCCAGATACTTTCTTTCAATCTCGAGATTGAAAGAAAGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004568.4-1025s1c1
Sequence:CCGGCAAATCTTGGTGCTTCCATATCTCGAGATATGGAAGCACCAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004568.4-1190s1c1
Sequence:CCGGCCGCGGTTTAAACTAGAGGAACTCGAGTTCCTCTAGTTTAAACCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-737s1c1
Sequence:CCGGCTTGACTTTATCAGCGCCGTACTCGAGTACGGCGCTGATAAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-430s1c1
Sequence:CCGGGCTGGGTAAAGACAACTCGAACTCGAGTTCGAGTTGTCTTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004568
VALIDATED
SERPINB6 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade B (ovalbumin), member 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-1391s21c1
Sequence:CCGGATGATGCGGTGTGCCAGATTCCTCGAGGAATCTGGCACACCGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-1025s21c1
Sequence:CCGGCAAATCTTGGTGCTTCCATATCTCGAGATATGGAAGCACCAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-962s21c1
Sequence:CCGGCCTGTGCAAATGATGTTTAAGCTCGAGCTTAAACATCATTTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004568.4-536s21c1
Sequence:CCGGGCCCAGATACTTTCTTTCAATCTCGAGATTGAAAGAAAGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-536s1c1
Sequence:CCGGGCCCAGATACTTTCTTTCAATCTCGAGATTGAAAGAAAGTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004568.4-1025s1c1
Sequence:CCGGCAAATCTTGGTGCTTCCATATCTCGAGATATGGAAGCACCAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004568.4-1190s1c1
Sequence:CCGGCCGCGGTTTAAACTAGAGGAACTCGAGTTCCTCTAGTTTAAACCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-737s1c1
Sequence:CCGGCTTGACTTTATCAGCGCCGTACTCGAGTACGGCGCTGATAAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004568.4-430s1c1
Sequence:CCGGGCTGGGTAAAGACAACTCGAACTCGAGTTCGAGTTGTCTTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks