EMAIL THIS PAGE TO A FRIEND

SERPINC1

serpin peptidase inhibitor, clade C (antithrombin), member 1

Synonyms: AT3 AT3D ATIII THPH7
Gene ID:
Human(462) Summary: The protein encoded by this gene is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. More than 120 mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency. [provided by RefSeq, Jul 2009]
Mouse(11905) serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1
Rat(304917) serpin peptidase inhibitor, clade C (antithrombin), member 1
cow(540261) serpin peptidase inhibitor, clade C (antithrombin), member 1
sheep(443407) serpin peptidase inhibitor, clade C (antithrombin), member 1
domestic guinea pig(100379601) serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1
Domestic Rabbit(100355802) serpin peptidase inhibitor, clade C (antithrombin), member 1
naked mole-rat(101722222) serpin peptidase inhibitor, clade C (antithrombin), member 1
Zebrafish(321545) serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1
Horse(100061173) serpin peptidase inhibitor, clade C (antithrombin), member 1
domestic cat(101093983) serpin peptidase inhibitor, clade C (antithrombin), member 1
chicken(424440) serpin peptidase inhibitor, clade C (antithrombin), member 1
dog(480066) serpin peptidase inhibitor, clade C (antithrombin), member 1
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A9522 Anti-Antithrombin III antibody produced in rabbit fractionated antiserum, lyophilized powder human
ELISA pricing
GW20068F Anti-Antithrombin-III antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1104907 Anti-SERPINC1 (426-440) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1405495 Anti-SERPINC1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA001816 Anti-SERPINC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA024007 Anti-SERPINC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104708 Anti-SERPINC1 antibody produced in rabbit affinity isolated antibody guinea pig, horse, sheep, rabbit, human
western blot pricing
SAB2106551 Anti-SERPINC1 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, rabbit, sheep, human
ELISA, western blot pricing
A5816 Monoclonal Anti-Antithrombin III antibody produced in mouse clone BL-AT III/3, ascites fluid human
dot blot, ELISA, western blot pricing
WH0000462M2 Monoclonal Anti-SERPINC1 antibody produced in mouse clone 2B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403580 Monoclonal Anti-SERPINC1 antibody produced in mouse clone 2B12, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000488 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000488 Rosetta Predictions human pricing
NM_001012027 Rosetta Predictions rat pricing
XM_573487 Rosetta Predictions rat pricing
NM_080844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026832 predicted 570
2 SASI_Hs01_00026833 predicted 1264
3 SASI_Hs01_00026834 predicted 1272
4 SASI_Hs01_00026835 predicted 467
5 SASI_Hs02_00302641 predicted 513
6 SASI_Hs01_00026836 predicted 1335
7 SASI_Hs01_00026837 predicted 1321
8 SASI_Hs01_00026838 predicted 648
9 SASI_Hs01_00026839 predicted 1209
10 SASI_Hs01_00026840 predicted 880
11 SASI_Hs01_00026831 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106497 predicted 608
2 SASI_Rn01_00106498 predicted 614
3 SASI_Rn01_00106499 predicted 1302
4 SASI_Rn01_00106500 predicted 315
5 SASI_Rn01_00106501 predicted 356
6 SASI_Rn01_00106502 predicted 550
7 SASI_Rn01_00106503 predicted 321
8 SASI_Rn02_00200113 predicted 788
9 SASI_Rn01_00106505 predicted 706
10 SASI_Rn01_00106506 predicted 1282
11 SASI_Rn01_00106504 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194641 predicted 853
2 SASI_Rn01_00194642 predicted 952
3 SASI_Rn01_00194643 predicted 717
4 SASI_Rn01_00194644 predicted 853
5 SASI_Rn01_00194645 predicted 900
6 SASI_Rn01_00194646 predicted 906
7 SASI_Rn01_00194647 predicted 793
8 SASI_Rn01_00194648 predicted 855
9 SASI_Rn01_00194649 predicted 858
10 SASI_Rn01_00194650 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197230 predicted 1228
2 SASI_Mm01_00197231 predicted 312
3 SASI_Mm02_00338218 predicted 877
4 SASI_Mm01_00197232 predicted 1390
5 SASI_Mm01_00197233 predicted 1482
6 SASI_Mm01_00197235 predicted 197
7 SASI_Mm01_00197236 predicted 1480
8 SASI_Mm01_00197237 predicted 1384
9 SASI_Mm01_00197238 predicted 1425
10 SASI_Mm01_00197239 predicted 684
11 SASI_Mm01_00197234 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080844
SERPINC1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade C (antithrombin), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080844.2-1711s1c1
Sequence:CCGGCCATGTCTCAAGATGGTCTTTCTCGAGAAAGACCATCTTGAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-1395s1c1
Sequence:CCGGAGTTGCACTGAACACTATTATCTCGAGATAATAGTGTTCAGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-844s1c1
Sequence:CCGGCCTGAGAACACAAGGAAGGAACTCGAGTTCCTTCCTTGTGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-138s1c1
Sequence:CCGGCTGTGCTATCTGTCACGGAAACTCGAGTTTCCGTGACAGATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-1248s1c1
Sequence:CCGGCGACGCATTCCACAAAGCATTCTCGAGAATGCTTTGTGGAATGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080844
SERPINC1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade C (antithrombin), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080844.2-1711s1c1
Sequence:CCGGCCATGTCTCAAGATGGTCTTTCTCGAGAAAGACCATCTTGAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-1395s1c1
Sequence:CCGGAGTTGCACTGAACACTATTATCTCGAGATAATAGTGTTCAGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-844s1c1
Sequence:CCGGCCTGAGAACACAAGGAAGGAACTCGAGTTCCTTCCTTGTGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-138s1c1
Sequence:CCGGCTGTGCTATCTGTCACGGAAACTCGAGTTTCCGTGACAGATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-1248s1c1
Sequence:CCGGCGACGCATTCCACAAAGCATTCTCGAGAATGCTTTGTGGAATGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080844
SERPINC1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade C (antithrombin), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080844.2-1711s1c1
Sequence:CCGGCCATGTCTCAAGATGGTCTTTCTCGAGAAAGACCATCTTGAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-1395s1c1
Sequence:CCGGAGTTGCACTGAACACTATTATCTCGAGATAATAGTGTTCAGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-844s1c1
Sequence:CCGGCCTGAGAACACAAGGAAGGAACTCGAGTTCCTTCCTTGTGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-138s1c1
Sequence:CCGGCTGTGCTATCTGTCACGGAAACTCGAGTTTCCGTGACAGATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080844.2-1248s1c1
Sequence:CCGGCGACGCATTCCACAAAGCATTCTCGAGAATGCTTTGTGGAATGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000488
SERPINC1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade C (antithrombin), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-496s1c1
Sequence:CCGGGCCAACAAATCCTCCAAGTTACTCGAGTAACTTGGAGGATTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-1017s1c1
Sequence:CCGGGCTGGATGAATTGGAGGAGATCTCGAGATCTCCTCCAATTCATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-1195s1c1
Sequence:CCGGGCATTCCATAAGGCATTTCTTCTCGAGAAGAAATGCCTTATGGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-142s1c1
Sequence:CCGGCCCATGAATCCCATGTGCATTCTCGAGAATGCACATGGGATTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-264s1c1
Sequence:CCGGCCGCTTTGCTACCACTTTCTACTCGAGTAGAAAGTGGTAGCAAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000488.3-802s21c1
Sequence:CCGGGCCGAATCACCGATGTCATTCCTCGAGGAATGACATCGGTGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000488.3-693s21c1
Sequence:CCGGGACATCAGTGAGTTGGTATATCTCGAGATATACCAACTCACTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000488
SERPINC1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade C (antithrombin), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-496s1c1
Sequence:CCGGGCCAACAAATCCTCCAAGTTACTCGAGTAACTTGGAGGATTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-1017s1c1
Sequence:CCGGGCTGGATGAATTGGAGGAGATCTCGAGATCTCCTCCAATTCATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-1195s1c1
Sequence:CCGGGCATTCCATAAGGCATTTCTTCTCGAGAAGAAATGCCTTATGGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-142s1c1
Sequence:CCGGCCCATGAATCCCATGTGCATTCTCGAGAATGCACATGGGATTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-264s1c1
Sequence:CCGGCCGCTTTGCTACCACTTTCTACTCGAGTAGAAAGTGGTAGCAAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000488.3-802s21c1
Sequence:CCGGGCCGAATCACCGATGTCATTCCTCGAGGAATGACATCGGTGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000488.3-693s21c1
Sequence:CCGGGACATCAGTGAGTTGGTATATCTCGAGATATACCAACTCACTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000488
SERPINC1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade C (antithrombin), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-496s1c1
Sequence:CCGGGCCAACAAATCCTCCAAGTTACTCGAGTAACTTGGAGGATTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-1017s1c1
Sequence:CCGGGCTGGATGAATTGGAGGAGATCTCGAGATCTCCTCCAATTCATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-1195s1c1
Sequence:CCGGGCATTCCATAAGGCATTTCTTCTCGAGAAGAAATGCCTTATGGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-142s1c1
Sequence:CCGGCCCATGAATCCCATGTGCATTCTCGAGAATGCACATGGGATTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000488.1-264s1c1
Sequence:CCGGCCGCTTTGCTACCACTTTCTACTCGAGTAGAAAGTGGTAGCAAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000488.3-802s21c1
Sequence:CCGGGCCGAATCACCGATGTCATTCCTCGAGGAATGACATCGGTGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000488.3-693s21c1
Sequence:CCGGGACATCAGTGAGTTGGTATATCTCGAGATATACCAACTCACTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks