EMAIL THIS PAGE TO A FRIEND

SERPIND1

serpin peptidase inhibitor, clade D (heparin cofactor), member 1

Synonyms: D22S673 HC2 HCF2 HCII HLS2 LS2 THPH10
UniProtKB ID: P05546, B2RAI1, D3DX34, Q6IBZ5
Gene ID:
Human(3053) Summary: The product encoded by this gene is a serine proteinase inhibitor which rapidly inhibits thrombin in the presence of dermatan sulfate or heparin. The gene contains five exons and four introns. This protein shares homology with antithrombin III and other members of the alpha 1-antitrypsin superfamily. Mutations in this gene are associated with heparin cofactor II deficiency. [provided by RefSeq, Jul 2008]
Mouse(15160) serine (or cysteine) peptidase inhibitor, clade D, member 1
Rat(79224) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Zebrafish(359841) serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1
chicken(395877) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Horse(100629879) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
domestic cat(101085836) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
dog(100682658) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
naked mole-rat(101707136) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Domestic Rabbit(100009170) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
domestic guinea pig(100723038) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
cow(100125764) serpin peptidase inhibitor, clade D (heparin cofactor), member 1
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0513 AQUA Peptide NYNLVESL[K] human pricing
AQ0514 AQUA Peptide YEITTIHNLF[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150111 MISSION® esiRNA esiRNA human SERPIND1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000185 Rosetta Predictions human pricing
NM_024382 Rosetta Predictions rat pricing
NM_008223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112363 predicted 497
2 SASI_Hs01_00112364 predicted 530
3 SASI_Hs01_00112366 predicted 657
4 SASI_Hs01_00112367 predicted 638
5 SASI_Hs01_00112368 predicted 1139
6 SASI_Hs01_00112369 predicted 1218
7 SASI_Hs02_00302031 predicted 1122
8 SASI_Hs01_00112370 predicted 464
9 SASI_Hs01_00112371 predicted 549
10 SASI_Hs01_00112372 predicted 730
11 SASI_Hs01_00112365 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263978 predicted 577
2 SASI_Rn01_00048865 predicted 1040
3 SASI_Rn01_00048866 predicted 433
4 SASI_Rn01_00048867 predicted 843
5 SASI_Rn01_00048868 predicted 1452
6 SASI_Rn02_00263979 predicted 934
7 SASI_Rn01_00048869 predicted 1390
8 SASI_Rn02_00263980 predicted 641
9 SASI_Rn01_00048871 predicted 699
10 SASI_Rn01_00048872 predicted 1117
11 SASI_Rn01_00048864 predicted 1230
12 SASI_Rn01_00048870 predicted 1162
13 SASI_Rn01_00048873 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313411 predicted 744
2 SASI_Mm01_00178805 predicted 1449
3 SASI_Mm01_00178806 predicted 1470
4 SASI_Mm01_00178807 predicted 611
5 SASI_Mm01_00178808 predicted 1056
6 SASI_Mm01_00178809 predicted 1318
7 SASI_Mm01_00178810 predicted 1488
8 SASI_Mm01_00178811 predicted 803
9 SASI_Mm02_00313412 predicted 1400
10 SASI_Mm01_00178813 predicted 544
11 SASI_Mm01_00178812 predicted 488
12 SASI_Mm01_00178814 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000185
SERPIND1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000185.3-1237s21c1
Sequence:CCGGAGAAGTGCTTCTGCCGAAATTCTCGAGAATTTCGGCAGAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000185.3-1012s21c1
Sequence:CCGGGAATGAGAGAGAGGTAGTTAACTCGAGTTAACTACCTCTCTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000185.3-2066s21c1
Sequence:CCGGGGCTAATGTTAGGGCTTAATTCTCGAGAATTAAGCCCTAACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-544s1c1
Sequence:CCGGGCGATGGGTATGATTTCCTTACTCGAGTAAGGAAATCATACCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-855s1c1
Sequence:CCGGCCACATCATGAAGCTCACCAACTCGAGTTGGTGAGCTTCATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-653s1c1
Sequence:CCGGCCATTCATAATCTCTTCCGTACTCGAGTACGGAAGAGATTATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-432s1c1
Sequence:CCGGCCAGCGTCTTAACATCCTCAACTCGAGTTGAGGATGTTAAGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-718s1c1
Sequence:CCGGCGGTCAGTCAATGACCTTTATCTCGAGATAAAGGTCATTGACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000185
SERPIND1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000185.3-1237s21c1
Sequence:CCGGAGAAGTGCTTCTGCCGAAATTCTCGAGAATTTCGGCAGAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000185.3-1012s21c1
Sequence:CCGGGAATGAGAGAGAGGTAGTTAACTCGAGTTAACTACCTCTCTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000185.3-2066s21c1
Sequence:CCGGGGCTAATGTTAGGGCTTAATTCTCGAGAATTAAGCCCTAACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-544s1c1
Sequence:CCGGGCGATGGGTATGATTTCCTTACTCGAGTAAGGAAATCATACCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-855s1c1
Sequence:CCGGCCACATCATGAAGCTCACCAACTCGAGTTGGTGAGCTTCATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-653s1c1
Sequence:CCGGCCATTCATAATCTCTTCCGTACTCGAGTACGGAAGAGATTATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-432s1c1
Sequence:CCGGCCAGCGTCTTAACATCCTCAACTCGAGTTGAGGATGTTAAGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-718s1c1
Sequence:CCGGCGGTCAGTCAATGACCTTTATCTCGAGATAAAGGTCATTGACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000185
SERPIND1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000185.3-1237s21c1
Sequence:CCGGAGAAGTGCTTCTGCCGAAATTCTCGAGAATTTCGGCAGAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000185.3-1012s21c1
Sequence:CCGGGAATGAGAGAGAGGTAGTTAACTCGAGTTAACTACCTCTCTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000185.3-2066s21c1
Sequence:CCGGGGCTAATGTTAGGGCTTAATTCTCGAGAATTAAGCCCTAACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-544s1c1
Sequence:CCGGGCGATGGGTATGATTTCCTTACTCGAGTAAGGAAATCATACCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-855s1c1
Sequence:CCGGCCACATCATGAAGCTCACCAACTCGAGTTGGTGAGCTTCATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-653s1c1
Sequence:CCGGCCATTCATAATCTCTTCCGTACTCGAGTACGGAAGAGATTATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-432s1c1
Sequence:CCGGCCAGCGTCTTAACATCCTCAACTCGAGTTGAGGATGTTAAGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000185.2-718s1c1
Sequence:CCGGCGGTCAGTCAATGACCTTTATCTCGAGATAAAGGTCATTGACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008223
SERPIND1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000080213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-682s1c1
Sequence:CCGGCGGTCAGTTAATGGCCTTTATCTCGAGATAAAGGCCATTAACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-936s1c1
Sequence:CCGGCCCAGTAGAAATGACGCACAACTCGAGTTGTGCGTCATTTCTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-199s1c1
Sequence:CCGGCCTGCTAACTTCCACAAAGAACTCGAGTTCTTTGTGGAAGTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-874s1c1
Sequence:CCGGCCTGCTACTCAGATGCTGATTCTCGAGAATCAGCATCTGAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008223
SERPIND1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000080213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-682s1c1
Sequence:CCGGCGGTCAGTTAATGGCCTTTATCTCGAGATAAAGGCCATTAACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-936s1c1
Sequence:CCGGCCCAGTAGAAATGACGCACAACTCGAGTTGTGCGTCATTTCTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-199s1c1
Sequence:CCGGCCTGCTAACTTCCACAAAGAACTCGAGTTCTTTGTGGAAGTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-874s1c1
Sequence:CCGGCCTGCTACTCAGATGCTGATTCTCGAGAATCAGCATCTGAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008223
SERPIND1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade D (heparin cofactor), member 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000080213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-682s1c1
Sequence:CCGGCGGTCAGTTAATGGCCTTTATCTCGAGATAAAGGCCATTAACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-936s1c1
Sequence:CCGGCCCAGTAGAAATGACGCACAACTCGAGTTGTGCGTCATTTCTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-199s1c1
Sequence:CCGGCCTGCTAACTTCCACAAAGAACTCGAGTTCTTTGTGGAAGTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008223.1-874s1c1
Sequence:CCGGCCTGCTACTCAGATGCTGATTCTCGAGAATCAGCATCTGAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks