EMAIL THIS PAGE TO A FRIEND

SERPINH1

serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)

Synonyms: AsTP3 CBP1 CBP2 HSP47 OI10 PPROM RA-A47 SERPINH2 gp46
Gene ID:
Human(871) Summary: This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]
Mouse(12406) serine (or cysteine) peptidase inhibitor, clade H, member 1
Rat(29345) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
cow(510850) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
sheep(101109208) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
domestic guinea pig(100723980) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
naked mole-rat(101700507) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Domestic Rabbit(100009353) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
chicken(396228) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
domestic cat(101091396) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Horse(100064560) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
dog(485187) serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001235 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU043481 MISSION® esiRNA esiRNA targeting mouse Serpinh1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001235 Rosetta Predictions human pricing
NM_017173 Rosetta Predictions rat pricing
NM_001111043 Rosetta Predictions mouse pricing
NM_001111044 Rosetta Predictions mouse pricing
NM_009825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244794 predicted 1530
2 SASI_Hs01_00244796 predicted 1795
3 SASI_Hs01_00244797 predicted 1286
4 SASI_Hs01_00244798 predicted 913
5 SASI_Hs01_00244799 predicted 1232
6 SASI_Hs01_00244800 predicted 1405
7 SASI_Hs01_00244801 predicted 1799
8 SASI_Hs01_00244802 predicted 890
9 SASI_Hs01_00244803 predicted 1521
10 SASI_Hs02_00331406 predicted 1455
11 SASI_Hs01_00244795 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118837 predicted 964
2 SASI_Rn01_00118838 predicted 276
3 SASI_Rn01_00118839 predicted 1810
4 SASI_Rn01_00118840 predicted 1052
5 SASI_Rn01_00118841 predicted 741
6 SASI_Rn01_00118842 predicted 208
7 SASI_Rn01_00118843 predicted 590
8 SASI_Rn01_00118845 predicted 1777
9 SASI_Rn02_00261501 predicted 1764
10 SASI_Rn02_00261502 predicted 346
11 SASI_Rn01_00118836 predicted 901
12 SASI_Rn01_00118844 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306165 predicted 947
2 SASI_Mm02_00306166 predicted 856
3 SASI_Mm02_00306167 predicted 728
4 SASI_Mm02_00306168 predicted 894
5 SASI_Mm02_00306169 predicted 745
6 SASI_Mm02_00306170 predicted 559
7 SASI_Mm02_00306171 predicted 488
8 SASI_Mm02_00306172 predicted 1276
9 SASI_Mm02_00306173 predicted 984
10 SASI_Mm02_00306174 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306175 predicted 906
2 SASI_Mm02_00306176 predicted 817
3 SASI_Mm02_00306177 predicted 685
4 SASI_Mm02_00306178 predicted 847
5 SASI_Mm02_00306179 predicted 697
6 SASI_Mm02_00306180 predicted 513
7 SASI_Mm02_00306181 predicted 443
8 SASI_Mm02_00306182 predicted 1231
9 SASI_Mm02_00306183 predicted 946
10 SASI_Mm02_00306184 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072177 predicted 1078
2 SASI_Mm02_00317156 predicted 990
3 SASI_Mm01_00072180 predicted 858
4 SASI_Mm02_00317157 predicted 1024
5 SASI_Mm01_00072182 predicted 867
6 SASI_Mm01_00072183 predicted 690
7 SASI_Mm01_00072185 predicted 619
8 SASI_Mm02_00317158 predicted 1406
9 SASI_Mm02_00317159 predicted 1115
10 SASI_Mm02_00317160 predicted 1047
11 SASI_Mm01_00072178 predicted 708
12 SASI_Mm01_00072179 predicted 881
13 SASI_Mm01_00072181 predicted 1199
14 SASI_Mm01_00072184 predicted 858
15 SASI_Mm01_00072186 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009825
SERPINH1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-721s1c1
Sequence:CCGGCGAACACTCCAAGATCAACTTCTCGAGAAGTTGATCTTGGAGTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009825.1-1707s1c1
Sequence:CCGGCCAGATACTATGATACCAAATCTCGAGATTTGGTATCATAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-406s1c1
Sequence:CCGGCTTCAGCCTATATCAGGCGATCTCGAGATCGCCTGATATAGGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-1244s1c1
Sequence:CCGGGACAAGAACAAGGCAGACCTACTCGAGTAGGTCTGCCTTGTTCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-850s1c1
Sequence:CCGGGCTTGTGAACGCCATGTTCTTCTCGAGAAGAACATGGCGTTCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009825.2-1701s21c1
Sequence:CCGGTGAGACACATGGGTGCTATTGCTCGAGCAATAGCACCCATGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009825.2-1735s21c1
Sequence:CCGGAGGCACCAACCCTGGATATTCCTCGAGGAATATCCAGGGTTGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009825
SERPINH1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-721s1c1
Sequence:CCGGCGAACACTCCAAGATCAACTTCTCGAGAAGTTGATCTTGGAGTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009825.1-1707s1c1
Sequence:CCGGCCAGATACTATGATACCAAATCTCGAGATTTGGTATCATAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-406s1c1
Sequence:CCGGCTTCAGCCTATATCAGGCGATCTCGAGATCGCCTGATATAGGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-1244s1c1
Sequence:CCGGGACAAGAACAAGGCAGACCTACTCGAGTAGGTCTGCCTTGTTCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-850s1c1
Sequence:CCGGGCTTGTGAACGCCATGTTCTTCTCGAGAAGAACATGGCGTTCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009825.2-1701s21c1
Sequence:CCGGTGAGACACATGGGTGCTATTGCTCGAGCAATAGCACCCATGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009825.2-1735s21c1
Sequence:CCGGAGGCACCAACCCTGGATATTCCTCGAGGAATATCCAGGGTTGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009825
SERPINH1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-721s1c1
Sequence:CCGGCGAACACTCCAAGATCAACTTCTCGAGAAGTTGATCTTGGAGTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009825.1-1707s1c1
Sequence:CCGGCCAGATACTATGATACCAAATCTCGAGATTTGGTATCATAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-406s1c1
Sequence:CCGGCTTCAGCCTATATCAGGCGATCTCGAGATCGCCTGATATAGGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-1244s1c1
Sequence:CCGGGACAAGAACAAGGCAGACCTACTCGAGTAGGTCTGCCTTGTTCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009825.1-850s1c1
Sequence:CCGGGCTTGTGAACGCCATGTTCTTCTCGAGAAGAACATGGCGTTCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009825.2-1701s21c1
Sequence:CCGGTGAGACACATGGGTGCTATTGCTCGAGCAATAGCACCCATGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009825.2-1735s21c1
Sequence:CCGGAGGCACCAACCCTGGATATTCCTCGAGGAATATCCAGGGTTGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001235
VALIDATED
SERPINH1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001235.x-1894s1c1
Sequence:CCGGTCCCAACCTCTCCCAACTATACTCGAGTATAGTTGGGAGAGGTTGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001235.x-958s1c1
Sequence:CCGGCAACTACTACGACGACGAGAACTCGAGTTCTCGTCGTCGTAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001235.x-1295s1c1
Sequence:CCGGGCCTTTGAGTTGGACACAGATCTCGAGATCTGTGTCCAACTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001235.x-673s1c1
Sequence:CCGGCAGCAGCAAGCAGCACTACAACTCGAGTTGTAGTGCTGCTTGCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001235.x-952s1c1
Sequence:CCGGCCTCTACAACTACTACGACGACTCGAGTCGTCGTAGTAGTTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-952s21c1
Sequence:CCGGCCTCTACAACTACTACGACGACTCGAGTCGTCGTAGTAGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-673s21c1
Sequence:CCGGCAGCAGCAAGCAGCACTACAACTCGAGTTGTAGTGCTGCTTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001235.2-1894s21c1
Sequence:CCGGTCCCAACCTCTCCCAACTATACTCGAGTATAGTTGGGAGAGGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-1295s21c1
Sequence:CCGGGCCTTTGAGTTGGACACAGATCTCGAGATCTGTGTCCAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001235
VALIDATED
SERPINH1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001235.x-1894s1c1
Sequence:CCGGTCCCAACCTCTCCCAACTATACTCGAGTATAGTTGGGAGAGGTTGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001235.x-958s1c1
Sequence:CCGGCAACTACTACGACGACGAGAACTCGAGTTCTCGTCGTCGTAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001235.x-1295s1c1
Sequence:CCGGGCCTTTGAGTTGGACACAGATCTCGAGATCTGTGTCCAACTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001235.x-673s1c1
Sequence:CCGGCAGCAGCAAGCAGCACTACAACTCGAGTTGTAGTGCTGCTTGCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001235.x-952s1c1
Sequence:CCGGCCTCTACAACTACTACGACGACTCGAGTCGTCGTAGTAGTTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-952s21c1
Sequence:CCGGCCTCTACAACTACTACGACGACTCGAGTCGTCGTAGTAGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-673s21c1
Sequence:CCGGCAGCAGCAAGCAGCACTACAACTCGAGTTGTAGTGCTGCTTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001235.2-1894s21c1
Sequence:CCGGTCCCAACCTCTCCCAACTATACTCGAGTATAGTTGGGAGAGGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-1295s21c1
Sequence:CCGGGCCTTTGAGTTGGACACAGATCTCGAGATCTGTGTCCAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001235
VALIDATED
SERPINH1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001235.x-1894s1c1
Sequence:CCGGTCCCAACCTCTCCCAACTATACTCGAGTATAGTTGGGAGAGGTTGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001235.x-958s1c1
Sequence:CCGGCAACTACTACGACGACGAGAACTCGAGTTCTCGTCGTCGTAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001235.x-1295s1c1
Sequence:CCGGGCCTTTGAGTTGGACACAGATCTCGAGATCTGTGTCCAACTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001235.x-673s1c1
Sequence:CCGGCAGCAGCAAGCAGCACTACAACTCGAGTTGTAGTGCTGCTTGCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001235.x-952s1c1
Sequence:CCGGCCTCTACAACTACTACGACGACTCGAGTCGTCGTAGTAGTTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-952s21c1
Sequence:CCGGCCTCTACAACTACTACGACGACTCGAGTCGTCGTAGTAGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-673s21c1
Sequence:CCGGCAGCAGCAAGCAGCACTACAACTCGAGTTGTAGTGCTGCTTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001235.2-1894s21c1
Sequence:CCGGTCCCAACCTCTCCCAACTATACTCGAGTATAGTTGGGAGAGGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001235.2-1295s21c1
Sequence:CCGGGCCTTTGAGTTGGACACAGATCTCGAGATCTGTGTCCAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks