EMAIL THIS PAGE TO A FRIEND

SERPINI1

serpin peptidase inhibitor, clade I (neuroserpin), member 1

Synonyms: PI12 neuroserpin
UniProtKB ID: Q99574, A8K217, D3DNP1, Q6AHZ4
Gene ID:
Human(5274) Summary: This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(20713) serine (or cysteine) peptidase inhibitor, clade I, member 1
Rat(116459) serpin peptidase inhibitor, clade I (neuroserpin), member 1
Zebrafish(557627) serpin peptidase inhibitor, clade I (neuroserpin), member 1
dog(478684) serpin peptidase inhibitor, clade I (neuroserpin), member 1
domestic cat(101090383) serpin peptidase inhibitor, clade I (neuroserpin), member 1
Horse(100057410) serpin peptidase inhibitor, clade I (neuroserpin), member 1
chicken(425002) serpin peptidase inhibitor, clade I (neuroserpin), member 1
Domestic Rabbit(100341797) serpin peptidase inhibitor, clade I (neuroserpin), member 1
naked mole-rat(101716288) serpin peptidase inhibitor, clade I (neuroserpin), member 1
domestic guinea pig(100733658) serpin peptidase inhibitor, clade I (neuroserpin), member 1
cow(509976) serpin peptidase inhibitor, clade I (neuroserpin), member 1
sheep(101122566) serpin peptidase inhibitor, clade I (neuroserpin), member 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122752 Rosetta Predictions human pricing
NM_005025 Rosetta Predictions human pricing
NM_053779 Rosetta Predictions rat pricing
NM_009250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327285 predicted 1258
2 SASI_Hs02_00327286 predicted 726
3 SASI_Hs02_00327287 predicted 594
4 SASI_Hs02_00327288 predicted 845
5 SASI_Hs02_00327289 predicted 664
6 SASI_Hs02_00327290 predicted 898
7 SASI_Hs02_00327291 predicted 1418
8 SASI_Hs02_00327292 predicted 1412
9 SASI_Hs02_00327293 predicted 1391
10 SASI_Hs02_00327294 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116806 predicted 1489
2 SASI_Hs01_00116807 predicted 967
3 SASI_Hs01_00116808 predicted 827
4 SASI_Hs01_00116809 predicted 1073
5 SASI_Hs02_00338800 predicted 902
6 SASI_Hs01_00116811 predicted 1135
7 SASI_Hs01_00116812 predicted 1653
8 SASI_Hs02_00338801 predicted 1651
9 SASI_Hs02_00338802 predicted 1628
10 SASI_Hs02_00338803 predicted 628
11 SASI_Hs01_00116805 predicted 1564
12 SASI_Hs01_00116810 predicted 530
13 SASI_Hs01_00116813 predicted 950
14 SASI_Hs01_00116814 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033384 predicted 755
2 SASI_Rn01_00033385 predicted 644
3 SASI_Rn01_00033386 predicted 497
4 SASI_Rn01_00033388 predicted 821
5 SASI_Rn01_00033389 predicted 572
6 SASI_Rn02_00266585 predicted 1124
7 SASI_Rn01_00033390 predicted 315
8 SASI_Rn01_00033391 predicted 645
9 SASI_Rn01_00033392 predicted 749
10 SASI_Rn01_00033393 predicted 511
11 SASI_Rn01_00033387 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134658 predicted 1162
2 SASI_Mm01_00134659 predicted 1239
3 SASI_Mm01_00134660 predicted 320
4 SASI_Mm01_00134661 predicted 747
5 SASI_Mm01_00134662 predicted 1112
6 SASI_Mm02_00315728 predicted 1331
7 SASI_Mm01_00134663 predicted 1170
8 SASI_Mm01_00134664 predicted 833
9 SASI_Mm01_00134665 predicted 963
10 SASI_Mm01_00134666 predicted 1358
11 SASI_Mm01_00134667 predicted 621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005025
VALIDATED
SERPINI1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade I (neuroserpin), member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-723s21c1
Sequence:CCGGACTGCTAAAGAGAGCCAATATCTCGAGATATTGGCTCTCTTTAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-1447s21c1
Sequence:CCGGAGTCCTTCCTAGAGGTTAATGCTCGAGCATTAACCTCTAGGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-524s21c1
Sequence:CCGGGAATATGTATAATCGTCTTAGCTCGAGCTAAGACGATTATACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005025.1-617s1c1
Sequence:CCGGCCCTCATTAATGCTGTCTATTCTCGAGAATAGACAGCATTAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-1052s1c1
Sequence:CCGGGCCTCTCTGATAATAAGGAGACTCGAGTCTCCTTATTATCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-519s1c1
Sequence:CCGGCGTGGCCAACTACATCAATAACTCGAGTTATTGATGTAGTTGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-1171s1c1
Sequence:CCGGGCTGTGCTGTATCCTCAAGTTCTCGAGAACTTGAGGATACAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-406s1c1
Sequence:CCGGGCCAATTCCTTGTTTGTGCAACTCGAGTTGCACAAACAAGGAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005025
VALIDATED
SERPINI1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade I (neuroserpin), member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-723s21c1
Sequence:CCGGACTGCTAAAGAGAGCCAATATCTCGAGATATTGGCTCTCTTTAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-1447s21c1
Sequence:CCGGAGTCCTTCCTAGAGGTTAATGCTCGAGCATTAACCTCTAGGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-524s21c1
Sequence:CCGGGAATATGTATAATCGTCTTAGCTCGAGCTAAGACGATTATACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005025.1-617s1c1
Sequence:CCGGCCCTCATTAATGCTGTCTATTCTCGAGAATAGACAGCATTAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-1052s1c1
Sequence:CCGGGCCTCTCTGATAATAAGGAGACTCGAGTCTCCTTATTATCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-519s1c1
Sequence:CCGGCGTGGCCAACTACATCAATAACTCGAGTTATTGATGTAGTTGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-1171s1c1
Sequence:CCGGGCTGTGCTGTATCCTCAAGTTCTCGAGAACTTGAGGATACAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-406s1c1
Sequence:CCGGGCCAATTCCTTGTTTGTGCAACTCGAGTTGCACAAACAAGGAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005025
VALIDATED
SERPINI1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade I (neuroserpin), member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-723s21c1
Sequence:CCGGACTGCTAAAGAGAGCCAATATCTCGAGATATTGGCTCTCTTTAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-1447s21c1
Sequence:CCGGAGTCCTTCCTAGAGGTTAATGCTCGAGCATTAACCTCTAGGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005025.4-524s21c1
Sequence:CCGGGAATATGTATAATCGTCTTAGCTCGAGCTAAGACGATTATACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005025.1-617s1c1
Sequence:CCGGCCCTCATTAATGCTGTCTATTCTCGAGAATAGACAGCATTAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-1052s1c1
Sequence:CCGGGCCTCTCTGATAATAAGGAGACTCGAGTCTCCTTATTATCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-519s1c1
Sequence:CCGGCGTGGCCAACTACATCAATAACTCGAGTTATTGATGTAGTTGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-1171s1c1
Sequence:CCGGGCTGTGCTGTATCCTCAAGTTCTCGAGAACTTGAGGATACAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005025.1-406s1c1
Sequence:CCGGGCCAATTCCTTGTTTGTGCAACTCGAGTTGCACAAACAAGGAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009250
SERPINI1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade I (neuroserpin), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009250.1-1801s1c1
Sequence:CCGGGCAGAGAAATTGAGATTGTTACTCGAGTAACAATCTCAATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-533s1c1
Sequence:CCGGGCTGTGGCTAACTCCATCAATCTCGAGATTGATGGAGTTAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-705s1c1
Sequence:CCGGCCTTCACGAAAGATGATGAAACTCGAGTTTCATCATCTTTCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-633s1c1
Sequence:CCGGCCCTCATCAATGCTGTATATTCTCGAGAATATACAGCATTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-1161s1c1
Sequence:CCGGCCGGAATGATTGCGATTAGTACTCGAGTACTAATCGCAATCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009250
SERPINI1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade I (neuroserpin), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009250.1-1801s1c1
Sequence:CCGGGCAGAGAAATTGAGATTGTTACTCGAGTAACAATCTCAATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-533s1c1
Sequence:CCGGGCTGTGGCTAACTCCATCAATCTCGAGATTGATGGAGTTAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-705s1c1
Sequence:CCGGCCTTCACGAAAGATGATGAAACTCGAGTTTCATCATCTTTCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-633s1c1
Sequence:CCGGCCCTCATCAATGCTGTATATTCTCGAGAATATACAGCATTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-1161s1c1
Sequence:CCGGCCGGAATGATTGCGATTAGTACTCGAGTACTAATCGCAATCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009250
SERPINI1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade I (neuroserpin), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009250.1-1801s1c1
Sequence:CCGGGCAGAGAAATTGAGATTGTTACTCGAGTAACAATCTCAATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-533s1c1
Sequence:CCGGGCTGTGGCTAACTCCATCAATCTCGAGATTGATGGAGTTAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-705s1c1
Sequence:CCGGCCTTCACGAAAGATGATGAAACTCGAGTTTCATCATCTTTCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-633s1c1
Sequence:CCGGCCCTCATCAATGCTGTATATTCTCGAGAATATACAGCATTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009250.1-1161s1c1
Sequence:CCGGCCGGAATGATTGCGATTAGTACTCGAGTACTAATCGCAATCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks