EMAIL THIS PAGE TO A FRIEND

SERTAD1

SERTA domain containing 1

Synonyms: SEI1 TRIP-Br1
UniProtKB ID: Q9UHV2, Q9BUE7
Gene ID:
Mouse(55942) SERTA domain containing 1
Rat(361526) SERTA domain containing 1
domestic guinea pig(100723409) SERTA domain containing 1
naked mole-rat(101696649) SERTA domain containing 1
cow(539321) SERTA domain containing 1
sheep(101119071) SERTA domain containing 1
dog(484500) SERTA domain containing 1
domestic cat(101092811) SERTA domain containing 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013376 Rosetta Predictions human pricing
NM_001007735 Rosetta Predictions rat pricing
NM_018820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172183 predicted 667
2 SASI_Hs01_00172184 predicted 660
3 SASI_Hs02_00344724 predicted 204
4 SASI_Hs01_00172185 predicted 911
5 SASI_Hs01_00172187 predicted 271
6 SASI_Hs01_00172188 predicted 875
7 SASI_Hs01_00172189 predicted 794
8 SASI_Hs01_00172190 predicted 869
9 SASI_Hs01_00172191 predicted 682
10 SASI_Hs01_00172192 predicted 682
11 SASI_Hs01_00172186 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095533 predicted 754
2 SASI_Rn01_00095534 predicted 308
3 SASI_Rn01_00095535 predicted 821
4 SASI_Rn01_00095536 predicted 466
5 SASI_Rn01_00095537 predicted 877
6 SASI_Rn01_00095539 predicted 408
7 SASI_Rn02_00198923 predicted 916
8 SASI_Rn01_00095540 predicted 870
9 SASI_Rn02_00198924 predicted 855
10 SASI_Rn01_00095541 predicted 655
11 SASI_Rn01_00095532 predicted 239
12 SASI_Rn01_00095538 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089396 predicted 429
2 SASI_Mm01_00089397 predicted 965
3 SASI_Mm02_00324163 predicted 656
4 SASI_Mm01_00089398 predicted 349
5 SASI_Mm01_00089399 predicted 626
6 SASI_Mm01_00089400 predicted 617
7 SASI_Mm01_00089401 predicted 944
8 SASI_Mm01_00089403 predicted 705
9 SASI_Mm01_00089404 predicted 871
10 SASI_Mm01_00089405 predicted 929
11 SASI_Mm01_00089402 predicted 898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018820
VALIDATED
SERTAD1 MISSION shRNA Bacterial Glycerol Stock
SERTA domain containing 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-433s21c1
Sequence:CCGGAGCCTTCTGGCTAGCTCAGATCTCGAGATCTGAGCTAGCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-248s21c1
Sequence:CCGGTGGCTTCTAGCTCCCTCTTTGCTCGAGCAAAGAGGGAGCTAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018820.4-887s21c1
Sequence:CCGGTGGTGACACCAACCCACTTTGCTCGAGCAAAGTGGGTTGGTGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018820.4-645s21c1
Sequence:CCGGCCTGTTTGAGGACATCGATACCTCGAGGTATCGATGTCCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018820.4-485s21c1
Sequence:CCGGTGGAAGATCTCAACCACATTGCTCGAGCAATGTGGTTGAGATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-776s21c1
Sequence:CCGGACTACCTCATGGATGTACTAGCTCGAGCTAGTACATCCATGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-798s21c1
Sequence:CCGGAGGCACACAGGCACTGGAAAGCTCGAGCTTTCCAGTGCCTGTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018820.4-858s21c1
Sequence:CCGGGAATTGACTTGGATCTGAGTTCTCGAGAACTCAGATCCAAGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-329s21c1
Sequence:CCGGTGGTGCTTGTGGTGAACACACCTCGAGGTGTGTTCACCACAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018820.3-668s1c1
Sequence:CCGGCCATGTACGACAGTGAACTTTCTCGAGAAAGTTCACTGTCGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-858s1c1
Sequence:CCGGGAATTGACTTGGATCTGAGTTCTCGAGAACTCAGATCCAAGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-676s1c1
Sequence:CCGGGACAGTGAACTTTGGTTACCACTCGAGTGGTAACCAAAGTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-672s1c1
Sequence:CCGGGTACGACAGTGAACTTTGGTTCTCGAGAACCAAAGTTCACTGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018820
VALIDATED
SERTAD1 MISSION shRNA shRNA Plasmid DNA
SERTA domain containing 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-433s21c1
Sequence:CCGGAGCCTTCTGGCTAGCTCAGATCTCGAGATCTGAGCTAGCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-248s21c1
Sequence:CCGGTGGCTTCTAGCTCCCTCTTTGCTCGAGCAAAGAGGGAGCTAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018820.4-887s21c1
Sequence:CCGGTGGTGACACCAACCCACTTTGCTCGAGCAAAGTGGGTTGGTGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018820.4-645s21c1
Sequence:CCGGCCTGTTTGAGGACATCGATACCTCGAGGTATCGATGTCCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018820.4-485s21c1
Sequence:CCGGTGGAAGATCTCAACCACATTGCTCGAGCAATGTGGTTGAGATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-776s21c1
Sequence:CCGGACTACCTCATGGATGTACTAGCTCGAGCTAGTACATCCATGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-798s21c1
Sequence:CCGGAGGCACACAGGCACTGGAAAGCTCGAGCTTTCCAGTGCCTGTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018820.4-858s21c1
Sequence:CCGGGAATTGACTTGGATCTGAGTTCTCGAGAACTCAGATCCAAGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-329s21c1
Sequence:CCGGTGGTGCTTGTGGTGAACACACCTCGAGGTGTGTTCACCACAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018820.3-668s1c1
Sequence:CCGGCCATGTACGACAGTGAACTTTCTCGAGAAAGTTCACTGTCGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-858s1c1
Sequence:CCGGGAATTGACTTGGATCTGAGTTCTCGAGAACTCAGATCCAAGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-676s1c1
Sequence:CCGGGACAGTGAACTTTGGTTACCACTCGAGTGGTAACCAAAGTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-672s1c1
Sequence:CCGGGTACGACAGTGAACTTTGGTTCTCGAGAACCAAAGTTCACTGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018820
VALIDATED
SERTAD1 MISSION shRNA Lentiviral Transduction Particles
SERTA domain containing 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-433s21c1
Sequence:CCGGAGCCTTCTGGCTAGCTCAGATCTCGAGATCTGAGCTAGCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-248s21c1
Sequence:CCGGTGGCTTCTAGCTCCCTCTTTGCTCGAGCAAAGAGGGAGCTAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018820.4-887s21c1
Sequence:CCGGTGGTGACACCAACCCACTTTGCTCGAGCAAAGTGGGTTGGTGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018820.4-645s21c1
Sequence:CCGGCCTGTTTGAGGACATCGATACCTCGAGGTATCGATGTCCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018820.4-485s21c1
Sequence:CCGGTGGAAGATCTCAACCACATTGCTCGAGCAATGTGGTTGAGATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-776s21c1
Sequence:CCGGACTACCTCATGGATGTACTAGCTCGAGCTAGTACATCCATGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-798s21c1
Sequence:CCGGAGGCACACAGGCACTGGAAAGCTCGAGCTTTCCAGTGCCTGTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018820.4-858s21c1
Sequence:CCGGGAATTGACTTGGATCTGAGTTCTCGAGAACTCAGATCCAAGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018820.4-329s21c1
Sequence:CCGGTGGTGCTTGTGGTGAACACACCTCGAGGTGTGTTCACCACAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018820.3-668s1c1
Sequence:CCGGCCATGTACGACAGTGAACTTTCTCGAGAAAGTTCACTGTCGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-858s1c1
Sequence:CCGGGAATTGACTTGGATCTGAGTTCTCGAGAACTCAGATCCAAGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-676s1c1
Sequence:CCGGGACAGTGAACTTTGGTTACCACTCGAGTGGTAACCAAAGTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018820.3-672s1c1
Sequence:CCGGGTACGACAGTGAACTTTGGTTCTCGAGAACCAAAGTTCACTGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013376
VALIDATED
SERTAD1 MISSION shRNA Bacterial Glycerol Stock
SERTA domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-881s21c1
Sequence:CCGGTGGAATGGTTGTCTGGTATCTCTCGAGAGATACCAGACAACCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013376.3-671s21c1
Sequence:CCGGAGGGCCTGTTTGAGGATATTGCTCGAGCAATATCCTCAAACAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-295s21c1
Sequence:CCGGTTTGACCTCTCAGTGCTCAAGCTCGAGCTTGAGCACTGAGAGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-699s21c1
Sequence:CCGGTATGTATGACAATGAACTTTGCTCGAGCAAAGTTCATTGTCATACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013376.3-801s21c1
Sequence:CCGGATTGGACTACCTCATGGATGTCTCGAGACATCCATGAGGTAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-770s1c1
Sequence:CCGGGAATTGGACTACCTCATGGATCTCGAGATCCATGAGGTAGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013376.1-265s1c1
Sequence:CCGGCTTTGACCTCTCAGTGCTCAACTCGAGTTGAGCACTGAGAGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013376.1-850s1c1
Sequence:CCGGGCTGGAATGGTTGTCTGGTATCTCGAGATACCAGACAACCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-641s1c1
Sequence:CCGGGAGGGCCTGTTTGAGGATATTCTCGAGAATATCCTCAAACAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013376.1-921s1c1
Sequence:CCGGGCTTCCCTAGTACAGAGAACACTCGAGTGTTCTCTGTACTAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-677s1c1
Sequence:CCGGGACAATGAACTTTGGGCACCACTCGAGTGGTGCCCAAAGTTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013376
VALIDATED
SERTAD1 MISSION shRNA shRNA Plasmid DNA
SERTA domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-881s21c1
Sequence:CCGGTGGAATGGTTGTCTGGTATCTCTCGAGAGATACCAGACAACCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013376.3-671s21c1
Sequence:CCGGAGGGCCTGTTTGAGGATATTGCTCGAGCAATATCCTCAAACAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-295s21c1
Sequence:CCGGTTTGACCTCTCAGTGCTCAAGCTCGAGCTTGAGCACTGAGAGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-699s21c1
Sequence:CCGGTATGTATGACAATGAACTTTGCTCGAGCAAAGTTCATTGTCATACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013376.3-801s21c1
Sequence:CCGGATTGGACTACCTCATGGATGTCTCGAGACATCCATGAGGTAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-770s1c1
Sequence:CCGGGAATTGGACTACCTCATGGATCTCGAGATCCATGAGGTAGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013376.1-265s1c1
Sequence:CCGGCTTTGACCTCTCAGTGCTCAACTCGAGTTGAGCACTGAGAGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013376.1-850s1c1
Sequence:CCGGGCTGGAATGGTTGTCTGGTATCTCGAGATACCAGACAACCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-641s1c1
Sequence:CCGGGAGGGCCTGTTTGAGGATATTCTCGAGAATATCCTCAAACAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013376.1-921s1c1
Sequence:CCGGGCTTCCCTAGTACAGAGAACACTCGAGTGTTCTCTGTACTAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-677s1c1
Sequence:CCGGGACAATGAACTTTGGGCACCACTCGAGTGGTGCCCAAAGTTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013376
VALIDATED
SERTAD1 MISSION shRNA Lentiviral Transduction Particles
SERTA domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-881s21c1
Sequence:CCGGTGGAATGGTTGTCTGGTATCTCTCGAGAGATACCAGACAACCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013376.3-671s21c1
Sequence:CCGGAGGGCCTGTTTGAGGATATTGCTCGAGCAATATCCTCAAACAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-295s21c1
Sequence:CCGGTTTGACCTCTCAGTGCTCAAGCTCGAGCTTGAGCACTGAGAGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_013376.3-699s21c1
Sequence:CCGGTATGTATGACAATGAACTTTGCTCGAGCAAAGTTCATTGTCATACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013376.3-801s21c1
Sequence:CCGGATTGGACTACCTCATGGATGTCTCGAGACATCCATGAGGTAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-770s1c1
Sequence:CCGGGAATTGGACTACCTCATGGATCTCGAGATCCATGAGGTAGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013376.1-265s1c1
Sequence:CCGGCTTTGACCTCTCAGTGCTCAACTCGAGTTGAGCACTGAGAGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013376.1-850s1c1
Sequence:CCGGGCTGGAATGGTTGTCTGGTATCTCGAGATACCAGACAACCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-641s1c1
Sequence:CCGGGAGGGCCTGTTTGAGGATATTCTCGAGAATATCCTCAAACAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013376.1-921s1c1
Sequence:CCGGGCTTCCCTAGTACAGAGAACACTCGAGTGTTCTCTGTACTAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013376.1-677s1c1
Sequence:CCGGGACAATGAACTTTGGGCACCACTCGAGTGGTGCCCAAAGTTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks