EMAIL THIS PAGE TO A FRIEND

SETD9

SET domain containing 9

Synonyms: C5orf35
UniProtKB ID: Q8NE22, F5H713
Gene ID:
dog(608050) SET domain containing 9
domestic cat(101090838) SET domain containing 9
domestic guinea pig(100725121) SET domain containing 9
naked mole-rat(101720183) SET domain containing 9
cow(540253) SET domain containing 9
sheep(101112002) SET domain containing 9
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153706 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050071 MISSION® esiRNA esiRNA human C5orf35 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367430 predicted 1194
2 SASI_Hs01_00087808 predicted 820
3 SASI_Hs01_00087809 predicted 1257
4 SASI_Hs01_00087810 predicted 879
5 SASI_Hs01_00087811 predicted 1204
6 SASI_Hs01_00087812 predicted 928
7 SASI_Hs01_00087813 predicted 1263
8 SASI_Hs01_00087814 predicted 748
9 SASI_Hs02_00367431 predicted 703
10 SASI_Hs01_00087815 predicted 869
11 SASI_Hs01_00087816 predicted 530
12 SASI_Hs01_00087817 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153706
SETD9 MISSION shRNA Bacterial Glycerol Stock
SET domain containing 9
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1208s1c1
Sequence:CCGGGTCGCACTTAGGGACATCAATCTCGAGATTGATGTCCCTAAGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1163s1c1
Sequence:CCGGGCCTACAGCTATGACAAACAACTCGAGTTGTTTGTCATAGCTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153706.2-1011s1c1
Sequence:CCGGGTACATGGCTAACGTCAGAAACTCGAGTTTCTGACGTTAGCCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153706.2-783s1c1
Sequence:CCGGGTGTCTTCGTTACTAAAGGATCTCGAGATCCTTTAGTAACGAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1081s1c1
Sequence:CCGGCAGAGCAGCTAATGTCTGTTACTCGAGTAACAGACATTAGCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-874s1c1
Sequence:CCGGCCAGTCCATTGGAAATCCGTTCTCGAGAACGGATTTCCAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-416s1c1
Sequence:CCGGCGTTACAAGTACCGCTTCGTTCTCGAGAACGAAGCGGTACTTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-759s21c1
Sequence:CCGGGCCCAAGCAACTAGCTCATTGCTCGAGCAATGAGCTAGTTGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-614s21c1
Sequence:CCGGTATGCTTCCAGAATCTGTTAACTCGAGTTAACAGATTCTGGAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-843s21c1
Sequence:CCGGATGTATCCTGGTACAGTATATCTCGAGATATACTGTACCAGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153706.3-1519s21c1
Sequence:CCGGCCTAAATACACAATAGCTTATCTCGAGATAAGCTATTGTGTATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153706
SETD9 MISSION shRNA shRNA Plasmid DNA
SET domain containing 9
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1208s1c1
Sequence:CCGGGTCGCACTTAGGGACATCAATCTCGAGATTGATGTCCCTAAGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1163s1c1
Sequence:CCGGGCCTACAGCTATGACAAACAACTCGAGTTGTTTGTCATAGCTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153706.2-1011s1c1
Sequence:CCGGGTACATGGCTAACGTCAGAAACTCGAGTTTCTGACGTTAGCCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153706.2-783s1c1
Sequence:CCGGGTGTCTTCGTTACTAAAGGATCTCGAGATCCTTTAGTAACGAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1081s1c1
Sequence:CCGGCAGAGCAGCTAATGTCTGTTACTCGAGTAACAGACATTAGCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-874s1c1
Sequence:CCGGCCAGTCCATTGGAAATCCGTTCTCGAGAACGGATTTCCAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-416s1c1
Sequence:CCGGCGTTACAAGTACCGCTTCGTTCTCGAGAACGAAGCGGTACTTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-759s21c1
Sequence:CCGGGCCCAAGCAACTAGCTCATTGCTCGAGCAATGAGCTAGTTGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-614s21c1
Sequence:CCGGTATGCTTCCAGAATCTGTTAACTCGAGTTAACAGATTCTGGAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-843s21c1
Sequence:CCGGATGTATCCTGGTACAGTATATCTCGAGATATACTGTACCAGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153706.3-1519s21c1
Sequence:CCGGCCTAAATACACAATAGCTTATCTCGAGATAAGCTATTGTGTATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153706
SETD9 MISSION shRNA Lentiviral Transduction Particles
SET domain containing 9
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1208s1c1
Sequence:CCGGGTCGCACTTAGGGACATCAATCTCGAGATTGATGTCCCTAAGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1163s1c1
Sequence:CCGGGCCTACAGCTATGACAAACAACTCGAGTTGTTTGTCATAGCTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153706.2-1011s1c1
Sequence:CCGGGTACATGGCTAACGTCAGAAACTCGAGTTTCTGACGTTAGCCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153706.2-783s1c1
Sequence:CCGGGTGTCTTCGTTACTAAAGGATCTCGAGATCCTTTAGTAACGAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-1081s1c1
Sequence:CCGGCAGAGCAGCTAATGTCTGTTACTCGAGTAACAGACATTAGCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-874s1c1
Sequence:CCGGCCAGTCCATTGGAAATCCGTTCTCGAGAACGGATTTCCAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153706.2-416s1c1
Sequence:CCGGCGTTACAAGTACCGCTTCGTTCTCGAGAACGAAGCGGTACTTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-759s21c1
Sequence:CCGGGCCCAAGCAACTAGCTCATTGCTCGAGCAATGAGCTAGTTGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-614s21c1
Sequence:CCGGTATGCTTCCAGAATCTGTTAACTCGAGTTAACAGATTCTGGAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153706.3-843s21c1
Sequence:CCGGATGTATCCTGGTACAGTATATCTCGAGATATACTGTACCAGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153706.3-1519s21c1
Sequence:CCGGCCTAAATACACAATAGCTTATCTCGAGATAAGCTATTGTGTATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks