EMAIL THIS PAGE TO A FRIEND

SETMAR

SET domain and mariner transposase fusion gene

Synonyms: HsMar1 METNASE Mar1
UniProtKB ID: Q53H47, Q13579, Q1G668, Q96F41
Gene ID:
Human(6419) Summary: This gene encodes a fusion protein that contains an N-terminal histone-lysine N-methyltransferase domain and a C-terminal mariner transposase domain. The encoded protein binds DNA and functions in DNA repair activities including non-homologous end joining and double strand break repair. The SET domain portion of this protein specifically methylates histone H3 lysines 4 and 36. This gene exists as a fusion gene only in anthropoid primates, other organisms lack mariner transposase domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(74729) SET domain without mariner transposase fusion
Rat(500281) SET domain without mariner transposase fusion
naked mole-rat(101704237) SET domain and mariner transposase fusion gene
cow(511299) SET domain without mariner transposase fusion
sheep(101110273) SET domain gene
Zebrafish(564575) SET domain without mariner transposase fusion
domestic cat(101088560) SET domain without mariner transposase fusion
dog(476549) SET domain without mariner transposase fusion
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006515 Rosetta Predictions human pricing
XM_001071895 Rosetta Predictions rat pricing
XM_001078264 Rosetta Predictions rat pricing
XM_001001353 Rosetta Predictions mouse pricing
XM_982623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341737 predicted 780
2 SASI_Hs02_00341738 predicted 742
3 SASI_Hs02_00341739 predicted 819
4 SASI_Hs02_00341740 predicted 741
5 SASI_Hs02_00341741 predicted 733
6 SASI_Hs01_00082842 predicted 791
7 SASI_Hs01_00082843 predicted 780
8 SASI_Hs01_00082845 predicted 758
9 SASI_Hs02_00341742 predicted 795
10 SASI_Hs02_00341743 predicted 801
11 SASI_Hs01_00082838 predicted 522
12 SASI_Hs01_00082839 predicted 568
13 SASI_Hs01_00082840 predicted 450
14 SASI_Hs01_00082841 predicted 612
15 SASI_Hs01_00082844 predicted 571
16 SASI_Hs01_00082846 predicted 463
17 SASI_Hs01_00082847 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336911 predicted 1258
2 SASI_Rn02_00336912 predicted 1210
3 SASI_Rn02_00336913 predicted 1189
4 SASI_Rn02_00336914 predicted 1194
5 SASI_Rn02_00336915 predicted 1199
6 SASI_Rn02_00336916 predicted 1213
7 SASI_Rn02_00336917 predicted 1253
8 SASI_Rn02_00336918 predicted 1192
9 SASI_Rn02_00336919 predicted 1292
10 SASI_Rn02_00336920 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360170 predicted 795
2 SASI_Rn02_00360171 predicted 836
3 SASI_Rn02_00360172 predicted 914
4 SASI_Rn02_00360173 predicted 1195
5 SASI_Rn02_00360174 predicted 1170
6 SASI_Rn02_00360175 predicted 1141
7 SASI_Rn02_00360176 predicted 821
8 SASI_Rn02_00360177 predicted 797
9 SASI_Rn02_00360178 predicted 1145
10 SASI_Rn02_00360179 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355094 predicted 644
2 SASI_Mm02_00355095 predicted 801
3 SASI_Mm02_00355096 predicted 591
4 SASI_Mm02_00355097 predicted 598
5 SASI_Mm02_00355098 predicted 501
6 SASI_Mm02_00355099 predicted 320
7 SASI_Mm02_00355100 predicted 580
8 SASI_Mm02_00355101 predicted 518
9 SASI_Mm02_00355102 predicted 915
10 SASI_Mm02_00355103 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205186 predicted 801
2 SASI_Mm01_00205187 predicted 1173
3 SASI_Mm01_00205188 predicted 1187
4 SASI_Mm01_00205189 predicted 326
5 SASI_Mm01_00205190 predicted 309
6 SASI_Mm01_00205191 predicted 1352
7 SASI_Mm01_00205192 predicted 1161
8 SASI_Mm01_00205193 predicted 919
9 SASI_Mm02_00447902 predicted 979
10 SASI_Mm01_00205195 predicted 1183
11 SASI_Mm01_00205194 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006515
VALIDATED
SETMAR MISSION shRNA Bacterial Glycerol Stock
SET domain and mariner transposase fusion gene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006515.3-1175s21c1
Sequence:CCGGCGCAACATCAACAATGCATTTCTCGAGAAATGCATTGTTGATGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-893s21c1
Sequence:CCGGGAAAGGCTAGATCATGGGAAACTCGAGTTTCCCATGATCTAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006515.3-1387s21c1
Sequence:CCGGTTCTACGGTCGTTCGACATTTCTCGAGAAATGTCGAACGACCGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-629s21c1
Sequence:CCGGTCCGACTCCAATTACATTATACTCGAGTATAATGTAATTGGAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-491s21c1
Sequence:CCGGCAAGTGTTCAAGACGCATAAACTCGAGTTTATGCGTCTTGAACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-801s1c1
Sequence:CCGGGCCTCCAAAGAAAGGCTAGATCTCGAGATCTAGCCTTTCTTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-810s1c1
Sequence:CCGGGAAAGGCTAGATCATGGGAAACTCGAGTTTCCCATGATCTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-1092s1c1
Sequence:CCGGCGCAACATCAACAATGCATTTCTCGAGAAATGCATTGTTGATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-408s1c1
Sequence:CCGGCAAGTGTTCAAGACGCATAAACTCGAGTTTATGCGTCTTGAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006515
VALIDATED
SETMAR MISSION shRNA shRNA Plasmid DNA
SET domain and mariner transposase fusion gene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006515.3-1175s21c1
Sequence:CCGGCGCAACATCAACAATGCATTTCTCGAGAAATGCATTGTTGATGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-893s21c1
Sequence:CCGGGAAAGGCTAGATCATGGGAAACTCGAGTTTCCCATGATCTAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006515.3-1387s21c1
Sequence:CCGGTTCTACGGTCGTTCGACATTTCTCGAGAAATGTCGAACGACCGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-629s21c1
Sequence:CCGGTCCGACTCCAATTACATTATACTCGAGTATAATGTAATTGGAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-491s21c1
Sequence:CCGGCAAGTGTTCAAGACGCATAAACTCGAGTTTATGCGTCTTGAACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-801s1c1
Sequence:CCGGGCCTCCAAAGAAAGGCTAGATCTCGAGATCTAGCCTTTCTTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-810s1c1
Sequence:CCGGGAAAGGCTAGATCATGGGAAACTCGAGTTTCCCATGATCTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-1092s1c1
Sequence:CCGGCGCAACATCAACAATGCATTTCTCGAGAAATGCATTGTTGATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-408s1c1
Sequence:CCGGCAAGTGTTCAAGACGCATAAACTCGAGTTTATGCGTCTTGAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006515
VALIDATED
SETMAR MISSION shRNA Lentiviral Transduction Particles
SET domain and mariner transposase fusion gene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006515.3-1175s21c1
Sequence:CCGGCGCAACATCAACAATGCATTTCTCGAGAAATGCATTGTTGATGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-893s21c1
Sequence:CCGGGAAAGGCTAGATCATGGGAAACTCGAGTTTCCCATGATCTAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006515.3-1387s21c1
Sequence:CCGGTTCTACGGTCGTTCGACATTTCTCGAGAAATGTCGAACGACCGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-629s21c1
Sequence:CCGGTCCGACTCCAATTACATTATACTCGAGTATAATGTAATTGGAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006515.3-491s21c1
Sequence:CCGGCAAGTGTTCAAGACGCATAAACTCGAGTTTATGCGTCTTGAACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-801s1c1
Sequence:CCGGGCCTCCAAAGAAAGGCTAGATCTCGAGATCTAGCCTTTCTTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-810s1c1
Sequence:CCGGGAAAGGCTAGATCATGGGAAACTCGAGTTTCCCATGATCTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-1092s1c1
Sequence:CCGGCGCAACATCAACAATGCATTTCTCGAGAAATGCATTGTTGATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006515.1-408s1c1
Sequence:CCGGCAAGTGTTCAAGACGCATAAACTCGAGTTTATGCGTCTTGAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178391
VALIDATED
SETMAR MISSION shRNA Bacterial Glycerol Stock
SET domain and mariner transposase fusion gene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-833s1c1
Sequence:CCGGCCAAGTAAGTAGGAAAGACAACTCGAGTTGTCTTTCCTACTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-1158s1c1
Sequence:CCGGCCCACATTCAACTCAGCAATTCTCGAGAATTGCTGAGTTGAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-659s1c1
Sequence:CCGGCGACCCTACCTACATAGGAAACTCGAGTTTCCTATGTAGGTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-662s1c1
Sequence:CCGGCCCTACCTACATAGGAAATATCTCGAGATATTTCCTATGTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178391.2-300s1c1
Sequence:CCGGCGCCATGAGAATAACTACGATCTCGAGATCGTAGTTATTCTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178391
VALIDATED
SETMAR MISSION shRNA shRNA Plasmid DNA
SET domain and mariner transposase fusion gene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-833s1c1
Sequence:CCGGCCAAGTAAGTAGGAAAGACAACTCGAGTTGTCTTTCCTACTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-1158s1c1
Sequence:CCGGCCCACATTCAACTCAGCAATTCTCGAGAATTGCTGAGTTGAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-659s1c1
Sequence:CCGGCGACCCTACCTACATAGGAAACTCGAGTTTCCTATGTAGGTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-662s1c1
Sequence:CCGGCCCTACCTACATAGGAAATATCTCGAGATATTTCCTATGTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178391.2-300s1c1
Sequence:CCGGCGCCATGAGAATAACTACGATCTCGAGATCGTAGTTATTCTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178391
VALIDATED
SETMAR MISSION shRNA Lentiviral Transduction Particles
SET domain and mariner transposase fusion gene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-833s1c1
Sequence:CCGGCCAAGTAAGTAGGAAAGACAACTCGAGTTGTCTTTCCTACTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-1158s1c1
Sequence:CCGGCCCACATTCAACTCAGCAATTCTCGAGAATTGCTGAGTTGAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-659s1c1
Sequence:CCGGCGACCCTACCTACATAGGAAACTCGAGTTTCCTATGTAGGTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178391.2-662s1c1
Sequence:CCGGCCCTACCTACATAGGAAATATCTCGAGATATTTCCTATGTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178391.2-300s1c1
Sequence:CCGGCGCCATGAGAATAACTACGATCTCGAGATCGTAGTTATTCTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks