EMAIL THIS PAGE TO A FRIEND

SF3A3

splicing factor 3a, subunit 3, 60kDa

Synonyms: PRP9 PRPF9 SAP61 SF3a60
UniProtKB ID: Q12874, D3DPT5, Q15460, Q5VT87
Gene ID:
Human(10946) Summary: This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. [provided by RefSeq, Jul 2008]
Mouse(75062) splicing factor 3a, subunit 3
Rat(313583) splicing factor 3a, subunit 3
Zebrafish(446168) splicing factor 3a, subunit 3
chicken(419608) splicing factor 3a, subunit 3, 60kDa
Horse(100069044) splicing factor 3a, subunit 3, 60kDa
domestic cat(101092950) splicing factor 3a, subunit 3, 60kDa
dog(475326) splicing factor 3a, subunit 3, 60kDa
domestic guinea pig(100714532) splicing factor 3a, subunit 3, 60kDa
naked mole-rat(101705541) splicing factor 3a, subunit 3, 60kDa
Domestic Rabbit(100347092) splicing factor 3a, subunit 3, 60kDa
cow(523250) splicing factor 3a, subunit 3, 60kDa
sheep(101116775) splicing factor 3a, subunit 3, 60kDa
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006802 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006802 Rosetta Predictions human pricing
NM_001025698 Rosetta Predictions rat pricing
NM_029157 Rosetta Predictions mouse pricing
XM_620099 Rosetta Predictions mouse pricing
XM_896134 Rosetta Predictions mouse pricing
XM_974357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207261 predicted 525
2 SASI_Hs01_00207262 predicted 550
3 SASI_Hs01_00207263 predicted 1710
4 SASI_Hs01_00207265 predicted 587
5 SASI_Hs01_00207267 predicted 651
6 SASI_Hs01_00207268 predicted 708
7 SASI_Hs02_00342321 predicted 921
8 SASI_Hs01_00207269 predicted 305
9 SASI_Hs01_00207270 predicted 1590
10 SASI_Hs02_00342322 predicted 754
11 SASI_Hs01_00207264 predicted 919
12 SASI_Hs01_00207266 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078496 predicted 289
2 SASI_Rn01_00078497 predicted 1143
3 SASI_Rn01_00078498 predicted 785
4 SASI_Rn02_00203318 predicted 1363
5 SASI_Rn01_00078499 predicted 855
6 SASI_Rn01_00078500 predicted 520
7 SASI_Rn01_00078501 predicted 297
8 SASI_Rn01_00078502 predicted 862
9 SASI_Rn01_00078503 predicted 555
10 SASI_Rn01_00078504 predicted 462
11 SASI_Rn01_00078495 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334958 predicted 751
2 SASI_Mm02_00334959 predicted 520
3 SASI_Mm02_00334960 predicted 485
4 SASI_Mm02_00334961 predicted 676
5 SASI_Mm02_00334962 predicted 1358
6 SASI_Mm02_00334963 predicted 823
7 SASI_Mm02_00334964 predicted 341
8 SASI_Mm02_00334965 predicted 604
9 SASI_Mm02_00334966 predicted 291
10 SASI_Mm02_00334967 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280193 predicted 1428
2 SASI_Mm01_00280194 predicted 1420
3 SASI_Mm01_00280195 predicted 1404
4 SASI_Mm01_00280196 predicted 1453
5 SASI_Mm01_00280197 predicted 1468
6 SASI_Mm01_00280198 predicted 1564
7 SASI_Mm01_00280199 predicted 1488
8 SASI_Mm01_00280200 predicted 1507
9 SASI_Mm01_00280201 predicted 1485
10 SASI_Mm01_00280202 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212540 predicted 546
2 SASI_Mm01_00212541 predicted 617
3 SASI_Mm01_00212542 predicted 351
4 SASI_Mm01_00212543 predicted 604
5 SASI_Mm01_00212544 predicted 289
6 SASI_Mm01_00212545 predicted 427
7 SASI_Mm01_00212546 predicted 375
8 SASI_Mm01_00212547 predicted 528
9 SASI_Mm01_00212548 predicted 603
10 SASI_Mm01_00212549 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221249 predicted 1404
2 SASI_Mm01_00221250 predicted 1404
3 SASI_Mm01_00221251 predicted 1390
4 SASI_Mm01_00221252 predicted 1435
5 SASI_Mm01_00221253 predicted 1443
6 SASI_Mm01_00221254 predicted 1547
7 SASI_Mm01_00221255 predicted 1473
8 SASI_Mm01_00221256 predicted 1493
9 SASI_Mm01_00221257 predicted 1463
10 SASI_Mm01_00221258 predicted 1403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006802
VALIDATED
SF3A3 MISSION shRNA Bacterial Glycerol Stock
splicing factor 3a, subunit 3, 60kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006802.x-2486s1c1
Sequence:CCGGCATGTTCTCCAATCCCAGGTACTCGAGTACCTGGGATTGGAGAACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-942s1c1
Sequence:CCGGCGAGACACTGAAAGGAACAAACTCGAGTTTGTTCCTTTCAGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006802.x-1208s1c1
Sequence:CCGGTGGCCTAAATATCAACTACAACTCGAGTTGTAGTTGATATTTAGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-177s1c1
Sequence:CCGGCTGAGGGATTTGTATGATGATCTCGAGATCATCATACAAATCCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-268s1c1
Sequence:CCGGGACTCAAGCAAATAAAGGAATCTCGAGATTCCTTTATTTGCTTGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-2067s21c1
Sequence:GTACCGGTAGTTAGCCATTGATGCAAATCTCGAGATTTGCATCAATGGCTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006802.2-1314s21c1
Sequence:CCGGATAAGCTTCATGGCCTAAATACTCGAGTATTTAGGCCATGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-256s21c1
Sequence:CCGGGGCCATGCAAGATAGGTATATCTCGAGATATACCTATCTTGCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-615s21c1
Sequence:CCGGTGTCCATCTTTGACCAATTATCTCGAGATAATTGGTCAAAGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-585s21c1
Sequence:CCGGCATCTGAGAAGCTGGATTATACTCGAGTATAATCCAGCTTCTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006802
VALIDATED
SF3A3 MISSION shRNA shRNA Plasmid DNA
splicing factor 3a, subunit 3, 60kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006802.x-2486s1c1
Sequence:CCGGCATGTTCTCCAATCCCAGGTACTCGAGTACCTGGGATTGGAGAACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-942s1c1
Sequence:CCGGCGAGACACTGAAAGGAACAAACTCGAGTTTGTTCCTTTCAGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006802.x-1208s1c1
Sequence:CCGGTGGCCTAAATATCAACTACAACTCGAGTTGTAGTTGATATTTAGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-177s1c1
Sequence:CCGGCTGAGGGATTTGTATGATGATCTCGAGATCATCATACAAATCCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-268s1c1
Sequence:CCGGGACTCAAGCAAATAAAGGAATCTCGAGATTCCTTTATTTGCTTGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-2067s21c1
Sequence:GTACCGGTAGTTAGCCATTGATGCAAATCTCGAGATTTGCATCAATGGCTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006802.2-1314s21c1
Sequence:CCGGATAAGCTTCATGGCCTAAATACTCGAGTATTTAGGCCATGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-256s21c1
Sequence:CCGGGGCCATGCAAGATAGGTATATCTCGAGATATACCTATCTTGCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-615s21c1
Sequence:CCGGTGTCCATCTTTGACCAATTATCTCGAGATAATTGGTCAAAGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-585s21c1
Sequence:CCGGCATCTGAGAAGCTGGATTATACTCGAGTATAATCCAGCTTCTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006802
VALIDATED
SF3A3 MISSION shRNA Lentiviral Transduction Particles
splicing factor 3a, subunit 3, 60kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006802.x-2486s1c1
Sequence:CCGGCATGTTCTCCAATCCCAGGTACTCGAGTACCTGGGATTGGAGAACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-942s1c1
Sequence:CCGGCGAGACACTGAAAGGAACAAACTCGAGTTTGTTCCTTTCAGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006802.x-1208s1c1
Sequence:CCGGTGGCCTAAATATCAACTACAACTCGAGTTGTAGTTGATATTTAGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-177s1c1
Sequence:CCGGCTGAGGGATTTGTATGATGATCTCGAGATCATCATACAAATCCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006802.x-268s1c1
Sequence:CCGGGACTCAAGCAAATAAAGGAATCTCGAGATTCCTTTATTTGCTTGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-2067s21c1
Sequence:GTACCGGTAGTTAGCCATTGATGCAAATCTCGAGATTTGCATCAATGGCTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006802.2-1314s21c1
Sequence:CCGGATAAGCTTCATGGCCTAAATACTCGAGTATTTAGGCCATGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-256s21c1
Sequence:CCGGGGCCATGCAAGATAGGTATATCTCGAGATATACCTATCTTGCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-615s21c1
Sequence:CCGGTGTCCATCTTTGACCAATTATCTCGAGATAATTGGTCAAAGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006802.2-585s21c1
Sequence:CCGGCATCTGAGAAGCTGGATTATACTCGAGTATAATCCAGCTTCTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029157
VALIDATED
SF3A3 MISSION shRNA Bacterial Glycerol Stock
splicing factor 3a, subunit 3, 60kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029157.2-1610s1c1
Sequence:CCGGCCCAACCAAATGTTCTTAAAGCTCGAGCTTTAAGAACATTTGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1271s1c1
Sequence:CCGGGCCTGAATATCAACTACAACTCTCGAGAGTTGTAGTTGATATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1611s1c1
Sequence:CCGGCCAACCAAATGTTCTTAAAGACTCGAGTCTTTAAGAACATTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-558s1c1
Sequence:CCGGCCTGTCCATCTTTGACCAGTTCTCGAGAACTGGTCAAAGATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1612s1c1
Sequence:CCGGCAACCAAATGTTCTTAAAGACCTCGAGGTCTTTAAGAACATTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-129s21c1
Sequence:CCGGCGCTTCGGGACCAGATCAATTCTCGAGAATTGATCTGGTCCCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-1236s21c1
Sequence:CCGGGCCTGAATATCAACTACAACTCTCGAGAGTTGTAGTTGATATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-684s21c1
Sequence:CCGGTTGAGAAGAAGTGGGATAATGCTCGAGCATTATCCCACTTCTTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-1576s21c1
Sequence:CCGGCCAACCAAATGTTCTTAAAGACTCGAGTCTTTAAGAACATTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-523s21c1
Sequence:CCGGCCTGTCCATCTTTGACCAGTTCTCGAGAACTGGTCAAAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029157
VALIDATED
SF3A3 MISSION shRNA shRNA Plasmid DNA
splicing factor 3a, subunit 3, 60kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029157.2-1610s1c1
Sequence:CCGGCCCAACCAAATGTTCTTAAAGCTCGAGCTTTAAGAACATTTGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1271s1c1
Sequence:CCGGGCCTGAATATCAACTACAACTCTCGAGAGTTGTAGTTGATATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1611s1c1
Sequence:CCGGCCAACCAAATGTTCTTAAAGACTCGAGTCTTTAAGAACATTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-558s1c1
Sequence:CCGGCCTGTCCATCTTTGACCAGTTCTCGAGAACTGGTCAAAGATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1612s1c1
Sequence:CCGGCAACCAAATGTTCTTAAAGACCTCGAGGTCTTTAAGAACATTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-129s21c1
Sequence:CCGGCGCTTCGGGACCAGATCAATTCTCGAGAATTGATCTGGTCCCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-1236s21c1
Sequence:CCGGGCCTGAATATCAACTACAACTCTCGAGAGTTGTAGTTGATATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-684s21c1
Sequence:CCGGTTGAGAAGAAGTGGGATAATGCTCGAGCATTATCCCACTTCTTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-1576s21c1
Sequence:CCGGCCAACCAAATGTTCTTAAAGACTCGAGTCTTTAAGAACATTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-523s21c1
Sequence:CCGGCCTGTCCATCTTTGACCAGTTCTCGAGAACTGGTCAAAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029157
VALIDATED
SF3A3 MISSION shRNA Lentiviral Transduction Particles
splicing factor 3a, subunit 3, 60kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029157.2-1610s1c1
Sequence:CCGGCCCAACCAAATGTTCTTAAAGCTCGAGCTTTAAGAACATTTGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1271s1c1
Sequence:CCGGGCCTGAATATCAACTACAACTCTCGAGAGTTGTAGTTGATATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1611s1c1
Sequence:CCGGCCAACCAAATGTTCTTAAAGACTCGAGTCTTTAAGAACATTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-558s1c1
Sequence:CCGGCCTGTCCATCTTTGACCAGTTCTCGAGAACTGGTCAAAGATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029157.2-1612s1c1
Sequence:CCGGCAACCAAATGTTCTTAAAGACCTCGAGGTCTTTAAGAACATTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-129s21c1
Sequence:CCGGCGCTTCGGGACCAGATCAATTCTCGAGAATTGATCTGGTCCCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-1236s21c1
Sequence:CCGGGCCTGAATATCAACTACAACTCTCGAGAGTTGTAGTTGATATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-684s21c1
Sequence:CCGGTTGAGAAGAAGTGGGATAATGCTCGAGCATTATCCCACTTCTTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-1576s21c1
Sequence:CCGGCCAACCAAATGTTCTTAAAGACTCGAGTCTTTAAGAACATTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029157.3-523s21c1
Sequence:CCGGCCTGTCCATCTTTGACCAGTTCTCGAGAACTGGTCAAAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks