EMAIL THIS PAGE TO A FRIEND

SFPQ

splicing factor proline/glutamine-rich

Synonyms: POMP100 PSF
UniProtKB ID: P23246, P30808, Q5SZ71
Gene ID:
Mouse(71514) splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Rat(252855) splicing factor proline/glutamine-rich
Zebrafish(406564) splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
dog(100688260) splicing factor proline/glutamine-rich
domestic cat(101085303) splicing factor proline/glutamine-rich
chicken(395803) splicing factor proline/glutamine-rich
domestic guinea pig(100735195) splicing factor proline/glutamine-rich
naked mole-rat(101707841) splicing factor proline/glutamine-rich
cow(618226) splicing factor proline/glutamine-rich
sheep(101115249) splicing factor proline/glutamine-rich
190 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40572 Anti-SFPQ (AB1) antibody produced in rabbit IgG fraction of antiserum rat, bovine, human, mouse
immunohistochemistry, western blot pricing
AV40571 Anti-SFPQ (AB2) antibody produced in rabbit IgG fraction of antiserum human, horse, canine, rabbit, zebrafish, rat, mouse, guinea pig, bovine,
immunohistochemistry, western blot pricing
SAB2702488 Anti-Sfpq antibody produced in rabbit affinity isolated antibody zebrafish
pricing
HPA047513 Anti-SFPQ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA054689 Anti-SFPQ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0006421M2 Monoclonal Anti-SFPQ antibody produced in mouse clone 6D7, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404362 Monoclonal Anti-SFPQ antibody produced in mouse clone 3B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200501 Monoclonal Anti-SFPQ antibody produced in mouse ~1.0 mg/mL, clone FC23, purified immunoglobulin mouse, human, rat
immunofluorescence, western blot pricing
PLA0181 Rabbit anti-PSF/SFPQ Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, dog, ferret, rhesus monkey, gibbon, human, rat, primate, bovine, chimpanzee
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005066 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005066 Rosetta Predictions human pricing
NM_001025271 Rosetta Predictions rat pricing
XM_001058863 Rosetta Predictions rat pricing
NM_023603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073161 predicted 1112
2 SASI_Hs01_00073163 predicted 1868
3 SASI_Hs01_00073164 predicted 1545
4 SASI_Hs01_00073165 predicted 1649
5 SASI_Hs01_00073167 predicted 1837
6 SASI_Hs02_00338882 predicted 1358
7 SASI_Hs01_00073169 predicted 1079
8 SASI_Hs02_00338883 predicted 1425
9 SASI_Hs02_00338884 predicted 1560
10 SASI_Hs02_00338885 predicted 1628
11 SASI_Hs01_00073160 predicted 1261
12 SASI_Hs01_00073162 predicted 1302
13 SASI_Hs01_00073166 predicted 1883
14 SASI_Hs01_00073168 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203084 predicted 1465
2 SASI_Rn01_00044379 predicted 1844
3 SASI_Rn01_00044380 predicted 1386
4 SASI_Rn01_00044381 predicted 1175
5 SASI_Rn01_00044382 predicted 868
6 SASI_Rn01_00044383 predicted 1870
7 SASI_Rn01_00044385 predicted 1928
8 SASI_Rn01_00044386 predicted 1519
9 SASI_Rn01_00044387 predicted 1375
10 SASI_Rn02_00203085 predicted 1184
11 SASI_Rn01_00044378 predicted 1700
12 SASI_Rn01_00044384 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291102 predicted 1553
2 SASI_Rn02_00291103 predicted 1934
3 SASI_Rn02_00291104 predicted 1479
4 SASI_Rn02_00291105 predicted 1253
5 SASI_Rn02_00291106 predicted 960
6 SASI_Rn02_00291107 predicted 1962
7 SASI_Rn02_00291108 predicted 2018
8 SASI_Rn02_00291109 predicted 1606
9 SASI_Rn02_00291110 predicted 764
10 SASI_Rn02_00291111 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060637 predicted 2140
2 SASI_Mm01_00060639 predicted 1503
3 SASI_Mm01_00060640 predicted 1088
4 SASI_Mm01_00060641 predicted 1604
5 SASI_Mm01_00060642 predicted 1528
6 SASI_Mm01_00060643 predicted 1472
7 SASI_Mm01_00060644 predicted 1265
8 SASI_Mm01_00060645 predicted 1618
9 SASI_Mm01_00060646 predicted 1267
10 SASI_Mm02_00327208 predicted 1252
11 SASI_Mm01_00060638 predicted 1643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005066
VALIDATED
SFPQ MISSION shRNA Bacterial Glycerol Stock
splicing factor proline/glutamine-rich
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1483s21c1
Sequence:CCGGGCCCAGAAGAATCCAATGTATCTCGAGATACATTGGATTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1208s21c1
Sequence:CCGGCCCTTTCTGTTCGTAATCTTTCTCGAGAAAGATTACGAACAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-985s21c1
Sequence:CCGGCGGTTGTTTGTTGGGAATCTACTCGAGTAGATTCCCAACAAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1863s21c1
Sequence:CCGGGCGCCAAAGAGAGGAAAGTTACTCGAGTAACTTTCCTCTCTTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005066.x-977s1c1
Sequence:CCGGCGGTTGTTTGTTGGGAATCTACTCGAGTAGATTCCCAACAAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005066.x-2993s1c1
Sequence:CCGGGACCAACAAATCTCAAGCCCTCTCGAGAGGGCTTGAGATTTGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005066.x-1855s1c1
Sequence:CCGGGCGCCAAAGAGAGGAAAGTTACTCGAGTAACTTTCCTCTCTTTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005066.x-1200s1c1
Sequence:CCGGCCCTTTCTGTTCGTAATCTTTCTCGAGAAAGATTACGAACAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.x-1475s1c1
Sequence:CCGGGCCCAGAAGAATCCAATGTATCTCGAGATACATTGGATTCTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005066
VALIDATED
SFPQ MISSION shRNA shRNA Plasmid DNA
splicing factor proline/glutamine-rich
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1483s21c1
Sequence:CCGGGCCCAGAAGAATCCAATGTATCTCGAGATACATTGGATTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1208s21c1
Sequence:CCGGCCCTTTCTGTTCGTAATCTTTCTCGAGAAAGATTACGAACAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-985s21c1
Sequence:CCGGCGGTTGTTTGTTGGGAATCTACTCGAGTAGATTCCCAACAAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1863s21c1
Sequence:CCGGGCGCCAAAGAGAGGAAAGTTACTCGAGTAACTTTCCTCTCTTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005066.x-977s1c1
Sequence:CCGGCGGTTGTTTGTTGGGAATCTACTCGAGTAGATTCCCAACAAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005066.x-2993s1c1
Sequence:CCGGGACCAACAAATCTCAAGCCCTCTCGAGAGGGCTTGAGATTTGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005066.x-1855s1c1
Sequence:CCGGGCGCCAAAGAGAGGAAAGTTACTCGAGTAACTTTCCTCTCTTTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005066.x-1200s1c1
Sequence:CCGGCCCTTTCTGTTCGTAATCTTTCTCGAGAAAGATTACGAACAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.x-1475s1c1
Sequence:CCGGGCCCAGAAGAATCCAATGTATCTCGAGATACATTGGATTCTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005066
VALIDATED
SFPQ MISSION shRNA Lentiviral Transduction Particles
splicing factor proline/glutamine-rich
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1483s21c1
Sequence:CCGGGCCCAGAAGAATCCAATGTATCTCGAGATACATTGGATTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1208s21c1
Sequence:CCGGCCCTTTCTGTTCGTAATCTTTCTCGAGAAAGATTACGAACAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-985s21c1
Sequence:CCGGCGGTTGTTTGTTGGGAATCTACTCGAGTAGATTCCCAACAAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.2-1863s21c1
Sequence:CCGGGCGCCAAAGAGAGGAAAGTTACTCGAGTAACTTTCCTCTCTTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005066.x-977s1c1
Sequence:CCGGCGGTTGTTTGTTGGGAATCTACTCGAGTAGATTCCCAACAAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005066.x-2993s1c1
Sequence:CCGGGACCAACAAATCTCAAGCCCTCTCGAGAGGGCTTGAGATTTGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005066.x-1855s1c1
Sequence:CCGGGCGCCAAAGAGAGGAAAGTTACTCGAGTAACTTTCCTCTCTTTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005066.x-1200s1c1
Sequence:CCGGCCCTTTCTGTTCGTAATCTTTCTCGAGAAAGATTACGAACAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005066.x-1475s1c1
Sequence:CCGGGCCCAGAAGAATCCAATGTATCTCGAGATACATTGGATTCTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023603
SFPQ MISSION shRNA Bacterial Glycerol Stock
splicing factor proline/glutamine-rich
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1233s1c1
Sequence:CCGGGCCAGTTTGGTCCTATTGAAACTCGAGTTTCAATAGGACCAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1684s1c1
Sequence:CCGGCCAGGAAGAATTAAGGCGCATCTCGAGATGCGCCTTAATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023603.2-2232s1c1
Sequence:CCGGCCACTTAAATTCTTGGCATTTCTCGAGAAATGCCAAGAATTTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1388s1c1
Sequence:CCGGCCAGTCATTGTGGAACCACTTCTCGAGAAGTGGTTCCACAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1837s1c1
Sequence:CCGGAGAAGAAAGTTACAGCAGGATCTCGAGATCCTGCTGTAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023603
SFPQ MISSION shRNA shRNA Plasmid DNA
splicing factor proline/glutamine-rich
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1233s1c1
Sequence:CCGGGCCAGTTTGGTCCTATTGAAACTCGAGTTTCAATAGGACCAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1684s1c1
Sequence:CCGGCCAGGAAGAATTAAGGCGCATCTCGAGATGCGCCTTAATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023603.2-2232s1c1
Sequence:CCGGCCACTTAAATTCTTGGCATTTCTCGAGAAATGCCAAGAATTTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1388s1c1
Sequence:CCGGCCAGTCATTGTGGAACCACTTCTCGAGAAGTGGTTCCACAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1837s1c1
Sequence:CCGGAGAAGAAAGTTACAGCAGGATCTCGAGATCCTGCTGTAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023603
SFPQ MISSION shRNA Lentiviral Transduction Particles
splicing factor proline/glutamine-rich
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1233s1c1
Sequence:CCGGGCCAGTTTGGTCCTATTGAAACTCGAGTTTCAATAGGACCAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1684s1c1
Sequence:CCGGCCAGGAAGAATTAAGGCGCATCTCGAGATGCGCCTTAATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023603.2-2232s1c1
Sequence:CCGGCCACTTAAATTCTTGGCATTTCTCGAGAAATGCCAAGAATTTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1388s1c1
Sequence:CCGGCCAGTCATTGTGGAACCACTTCTCGAGAAGTGGTTCCACAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023603.2-1837s1c1
Sequence:CCGGAGAAGAAAGTTACAGCAGGATCTCGAGATCCTGCTGTAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks