EMAIL THIS PAGE TO A FRIEND

SFRP5

secreted frizzled-related protein 5

Synonyms: SARP3
UniProtKB ID: Q5T4F7, O14780, Q86TH7
Gene ID:
Human(6425) Summary: Secreted frizzled-related protein 5 (SFRP5) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be involved in determining the polarity of photoreceptor cells in the retina. SFRP5 is highly expressed in the retinal pigment epithelium, and moderately expressed in the pancreas. [provided by RefSeq, Jul 2008]
Mouse(54612) secreted frizzled-related sequence protein 5
Rat(309377) secreted frizzled-related protein 5
Zebrafish(117510) secreted frizzled-related protein 5
dog(486826) secreted frizzled-related protein 5
domestic cat(101088696) secreted frizzled-related protein 5
chicken(423838) secreted frizzled-related protein 5
cow(282069) secreted frizzled-related protein 5
sheep(101109845) secreted frizzled-related protein 5
naked mole-rat(101703189) secreted frizzled-related protein 5
domestic guinea pig(100716325) secreted frizzled-related protein 5
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003015 Rosetta Predictions human pricing
NM_001107591 Rosetta Predictions rat pricing
NM_018780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205191 predicted 779
2 SASI_Hs01_00205192 predicted 1504
3 SASI_Hs01_00205193 predicted 597
4 SASI_Hs01_00205194 predicted 1069
5 SASI_Hs02_00334910 predicted 816
6 SASI_Hs01_00205195 predicted 1492
7 SASI_Hs01_00205196 predicted 749
8 SASI_Hs02_00334911 predicted 1012
9 SASI_Hs01_00205197 predicted 1212
10 SASI_Hs01_00205198 predicted 575
11 SASI_Hs01_00205199 predicted 1248
12 SASI_Hs01_00205200 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230345 predicted 826
2 SASI_Rn02_00230346 predicted 845
3 SASI_Rn02_00230347 predicted 1300
4 SASI_Rn02_00230348 predicted 847
5 SASI_Rn02_00230349 predicted 451
6 SASI_Rn02_00230350 predicted 1607
7 SASI_Rn02_00230351 predicted 775
8 SASI_Rn02_00230352 predicted 1592
9 SASI_Rn02_00230353 predicted 791
10 SASI_Rn02_00230354 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093982 predicted 708
2 SASI_Mm01_00093983 predicted 725
3 SASI_Mm01_00093984 predicted 283
4 SASI_Mm01_00093985 predicted 522
5 SASI_Mm01_00093986 predicted 674
6 SASI_Mm01_00093987 predicted 725
7 SASI_Mm01_00093988 predicted 907
8 SASI_Mm01_00093989 predicted 695
9 SASI_Mm01_00093990 predicted 723
10 SASI_Mm02_00324089 predicted 536
11 SASI_Mm01_00093991 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003015
SFRP5 MISSION shRNA Bacterial Glycerol Stock
secreted frizzled-related protein 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003015.2-1232s1c1
Sequence:CCGGCGAATGTTGTTACTGGCACAACTCGAGTTGTGCCAGTAACAACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-481s1c1
Sequence:CCGGCCACTCGGATACGCAGGTCTTCTCGAGAAGACCTGCGTATCCGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-766s1c1
Sequence:CCGGGCAGATGTGCTCCAGTGACTTCTCGAGAAGTCACTGGAGCACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-364s1c1
Sequence:CCGGGCTCTGCCACACGGTGGGCTACTCGAGTAGCCCACCGTGTGGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-1049s1c1
Sequence:CCGGGAGATGAAGTTTGCAGTCAAACTCGAGTTTGACTGCAAACTTCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003015.3-1506s21c1
Sequence:CCGGCAATATTAGGCTAAGCTATTTCTCGAGAAATAGCTTAGCCTAATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003015.3-252s21c1
Sequence:CCGGGCGAGGAGTACGACTACTATGCTCGAGCATAGTAGTCGTACTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003015.3-1424s21c1
Sequence:CCGGGCGGAGGTTTCAGAGTAGAAGCTCGAGCTTCTACTCTGAAACCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003015.3-1073s21c1
Sequence:CCGGTGCTCCCTCTACTACCCTTTCCTCGAGGAAAGGGTAGTAGAGGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003015
SFRP5 MISSION shRNA shRNA Plasmid DNA
secreted frizzled-related protein 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003015.2-1232s1c1
Sequence:CCGGCGAATGTTGTTACTGGCACAACTCGAGTTGTGCCAGTAACAACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-481s1c1
Sequence:CCGGCCACTCGGATACGCAGGTCTTCTCGAGAAGACCTGCGTATCCGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-766s1c1
Sequence:CCGGGCAGATGTGCTCCAGTGACTTCTCGAGAAGTCACTGGAGCACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-364s1c1
Sequence:CCGGGCTCTGCCACACGGTGGGCTACTCGAGTAGCCCACCGTGTGGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-1049s1c1
Sequence:CCGGGAGATGAAGTTTGCAGTCAAACTCGAGTTTGACTGCAAACTTCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003015.3-1506s21c1
Sequence:CCGGCAATATTAGGCTAAGCTATTTCTCGAGAAATAGCTTAGCCTAATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003015.3-252s21c1
Sequence:CCGGGCGAGGAGTACGACTACTATGCTCGAGCATAGTAGTCGTACTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003015.3-1424s21c1
Sequence:CCGGGCGGAGGTTTCAGAGTAGAAGCTCGAGCTTCTACTCTGAAACCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003015.3-1073s21c1
Sequence:CCGGTGCTCCCTCTACTACCCTTTCCTCGAGGAAAGGGTAGTAGAGGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003015
SFRP5 MISSION shRNA Lentiviral Transduction Particles
secreted frizzled-related protein 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003015.2-1232s1c1
Sequence:CCGGCGAATGTTGTTACTGGCACAACTCGAGTTGTGCCAGTAACAACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-481s1c1
Sequence:CCGGCCACTCGGATACGCAGGTCTTCTCGAGAAGACCTGCGTATCCGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-766s1c1
Sequence:CCGGGCAGATGTGCTCCAGTGACTTCTCGAGAAGTCACTGGAGCACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-364s1c1
Sequence:CCGGGCTCTGCCACACGGTGGGCTACTCGAGTAGCCCACCGTGTGGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003015.2-1049s1c1
Sequence:CCGGGAGATGAAGTTTGCAGTCAAACTCGAGTTTGACTGCAAACTTCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003015.3-1506s21c1
Sequence:CCGGCAATATTAGGCTAAGCTATTTCTCGAGAAATAGCTTAGCCTAATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003015.3-252s21c1
Sequence:CCGGGCGAGGAGTACGACTACTATGCTCGAGCATAGTAGTCGTACTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003015.3-1424s21c1
Sequence:CCGGGCGGAGGTTTCAGAGTAGAAGCTCGAGCTTCTACTCTGAAACCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003015.3-1073s21c1
Sequence:CCGGTGCTCCCTCTACTACCCTTTCCTCGAGGAAAGGGTAGTAGAGGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018780
SFRP5 MISSION shRNA Bacterial Glycerol Stock
secreted frizzled-related protein 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018780.2-1446s1c1
Sequence:CCGGCCGTACTTAGGGAATAGCTTTCTCGAGAAAGCTATTCCCTAAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-730s1c1
Sequence:CCGGCGCATTAAGGAGATCAAGATACTCGAGTATCTTGATCTCCTTAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-957s1c1
Sequence:CCGGCCGCTGGGACAAGAAGAATAACTCGAGTTATTCTTCTTGTCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-411s1c1
Sequence:CCGGCCACTCAGACACCCAGGTCTTCTCGAGAAGACCTGGGTGTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-1011s1c1
Sequence:CCGGCTATCCCTGTTCCCTCTACTACTCGAGTAGTAGAGGGAACAGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018780.3-1541s21c1
Sequence:CCGGATTGTGGGTCTCATCGCTAAGCTCGAGCTTAGCGATGAGACCCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018780.3-829s21c1
Sequence:CCGGCAGTGACTTTGTGGTCAAGATCTCGAGATCTTGACCACAAAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018780.3-1105s21c1
Sequence:CCGGGAAGTTTGCAGTCAAATTCATCTCGAGATGAATTTGACTGCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018780.3-1475s21c1
Sequence:CCGGATGTGAAGGACTACGGATACACTCGAGTGTATCCGTAGTCCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018780
SFRP5 MISSION shRNA shRNA Plasmid DNA
secreted frizzled-related protein 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018780.2-1446s1c1
Sequence:CCGGCCGTACTTAGGGAATAGCTTTCTCGAGAAAGCTATTCCCTAAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-730s1c1
Sequence:CCGGCGCATTAAGGAGATCAAGATACTCGAGTATCTTGATCTCCTTAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-957s1c1
Sequence:CCGGCCGCTGGGACAAGAAGAATAACTCGAGTTATTCTTCTTGTCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-411s1c1
Sequence:CCGGCCACTCAGACACCCAGGTCTTCTCGAGAAGACCTGGGTGTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-1011s1c1
Sequence:CCGGCTATCCCTGTTCCCTCTACTACTCGAGTAGTAGAGGGAACAGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018780.3-1541s21c1
Sequence:CCGGATTGTGGGTCTCATCGCTAAGCTCGAGCTTAGCGATGAGACCCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018780.3-829s21c1
Sequence:CCGGCAGTGACTTTGTGGTCAAGATCTCGAGATCTTGACCACAAAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018780.3-1105s21c1
Sequence:CCGGGAAGTTTGCAGTCAAATTCATCTCGAGATGAATTTGACTGCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018780.3-1475s21c1
Sequence:CCGGATGTGAAGGACTACGGATACACTCGAGTGTATCCGTAGTCCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018780
SFRP5 MISSION shRNA Lentiviral Transduction Particles
secreted frizzled-related protein 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018780.2-1446s1c1
Sequence:CCGGCCGTACTTAGGGAATAGCTTTCTCGAGAAAGCTATTCCCTAAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-730s1c1
Sequence:CCGGCGCATTAAGGAGATCAAGATACTCGAGTATCTTGATCTCCTTAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-957s1c1
Sequence:CCGGCCGCTGGGACAAGAAGAATAACTCGAGTTATTCTTCTTGTCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-411s1c1
Sequence:CCGGCCACTCAGACACCCAGGTCTTCTCGAGAAGACCTGGGTGTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018780.2-1011s1c1
Sequence:CCGGCTATCCCTGTTCCCTCTACTACTCGAGTAGTAGAGGGAACAGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018780.3-1541s21c1
Sequence:CCGGATTGTGGGTCTCATCGCTAAGCTCGAGCTTAGCGATGAGACCCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018780.3-829s21c1
Sequence:CCGGCAGTGACTTTGTGGTCAAGATCTCGAGATCTTGACCACAAAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018780.3-1105s21c1
Sequence:CCGGGAAGTTTGCAGTCAAATTCATCTCGAGATGAATTTGACTGCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018780.3-1475s21c1
Sequence:CCGGATGTGAAGGACTACGGATACACTCGAGTGTATCCGTAGTCCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks