EMAIL THIS PAGE TO A FRIEND

SFT2D2

SFT2 domain containing 2

Synonyms: UNQ512 dJ747L4.C1.2
UniProtKB ID: O95562, A8K2R0, Q6UWR8
Gene ID:
Mouse(108735) SFT2 domain containing 2
Rat(360868) SFT2 domain containing 2
cow(506944) SFT2 domain containing 2
sheep(101118149) SFT2 domain containing 2
domestic guinea pig(100726108) SFT2 domain containing 2
naked mole-rat(101699799) SFT2 domain containing 2
chicken(418373) SFT2 domain containing 2
domestic cat(101081353) SFT2 domain containing 2
dog(490357) SFT2 domain containing 2
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199344 Rosetta Predictions human pricing
NM_001034011 Rosetta Predictions rat pricing
NM_145512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372782 predicted 476
2 SASI_Hs01_00053088 predicted 354
3 SASI_Hs02_00372783 predicted 425
4 SASI_Hs02_00372784 predicted 201
5 SASI_Hs02_00372785 predicted 308
6 SASI_Hs02_00372786 predicted 345
7 SASI_Hs01_00053090 predicted 611
8 SASI_Hs02_00372787 predicted 389
9 SASI_Hs01_00053093 predicted 279
10 SASI_Hs01_00053094 predicted 607
11 SASI_Hs01_00053089 predicted 663
12 SASI_Hs01_00053091 predicted 360
13 SASI_Hs01_00053092 predicted 837
14 SASI_Hs01_00053095 predicted 329
15 SASI_Hs01_00053096 predicted 546
16 SASI_Hs01_00053097 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091482 predicted 959
2 SASI_Rn01_00091483 predicted 633
3 SASI_Rn01_00091484 predicted 363
4 SASI_Rn01_00091485 predicted 924
5 SASI_Rn01_00091486 predicted 571
6 SASI_Rn02_00203890 predicted 594
7 SASI_Rn02_00203891 predicted 646
8 SASI_Rn01_00091487 predicted 585
9 SASI_Rn01_00091488 predicted 642
10 SASI_Rn01_00091489 predicted 415
11 SASI_Rn01_00091490 predicted 220
12 SASI_Rn01_00091491 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340971 predicted 923
2 SASI_Mm01_00120717 predicted 378
3 SASI_Mm01_00120718 predicted 636
4 SASI_Mm01_00120719 predicted 379
5 SASI_Mm01_00120720 predicted 666
6 SASI_Mm01_00120721 predicted 659
7 SASI_Mm01_00120722 predicted 428
8 SASI_Mm01_00120723 predicted 658
9 SASI_Mm01_00120724 predicted 763
10 SASI_Mm01_00120725 predicted 223
11 SASI_Mm01_00120726 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199344
VALIDATED
SFT2D2 MISSION shRNA Bacterial Glycerol Stock
SFT2 domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-481s21c1
Sequence:CCGGAGCCTTTCCTTCATACCATTTCTCGAGAAATGGTATGAAGGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-507s21c1
Sequence:CCGGGGATGCTGTGAAGAAGTGTTTCTCGAGAAACACTTCTTCACAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-529s21c1
Sequence:CCGGGCCGTGTGTCTTGCATAATTCCTCGAGGAATTATGCAAGACACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-369s1c1
Sequence:CCGGGATTGCAACTATCATGGTGCTCTCGAGAGCACCATGATAGTTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-347s1c1
Sequence:CCGGGAATGTTTGAGCCTACTCGTTCTCGAGAACGAGTAGGCTCAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-145s1c1
Sequence:CCGGGCATCTTCATTAAGCTGGAGTCTCGAGACTCCAGCTTAATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199344.1-849s1c1
Sequence:CCGGCCTATTCAGCAACAGCACATACTCGAGTATGTGCTGTTGCTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-688s1c1
Sequence:CCGGCGAACATTTGAGGGTTACTTTCTCGAGAAAGTAACCCTCAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199344.1-149s1c1
Sequence:CCGGCTTCATTAAGCTGGAGTACCACTCGAGTGGTACTCCAGCTTAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199344
VALIDATED
SFT2D2 MISSION shRNA shRNA Plasmid DNA
SFT2 domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-481s21c1
Sequence:CCGGAGCCTTTCCTTCATACCATTTCTCGAGAAATGGTATGAAGGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-507s21c1
Sequence:CCGGGGATGCTGTGAAGAAGTGTTTCTCGAGAAACACTTCTTCACAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-529s21c1
Sequence:CCGGGCCGTGTGTCTTGCATAATTCCTCGAGGAATTATGCAAGACACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-369s1c1
Sequence:CCGGGATTGCAACTATCATGGTGCTCTCGAGAGCACCATGATAGTTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-347s1c1
Sequence:CCGGGAATGTTTGAGCCTACTCGTTCTCGAGAACGAGTAGGCTCAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-145s1c1
Sequence:CCGGGCATCTTCATTAAGCTGGAGTCTCGAGACTCCAGCTTAATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199344.1-849s1c1
Sequence:CCGGCCTATTCAGCAACAGCACATACTCGAGTATGTGCTGTTGCTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-688s1c1
Sequence:CCGGCGAACATTTGAGGGTTACTTTCTCGAGAAAGTAACCCTCAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199344.1-149s1c1
Sequence:CCGGCTTCATTAAGCTGGAGTACCACTCGAGTGGTACTCCAGCTTAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199344
VALIDATED
SFT2D2 MISSION shRNA Lentiviral Transduction Particles
SFT2 domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-481s21c1
Sequence:CCGGAGCCTTTCCTTCATACCATTTCTCGAGAAATGGTATGAAGGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-507s21c1
Sequence:CCGGGGATGCTGTGAAGAAGTGTTTCTCGAGAAACACTTCTTCACAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199344.2-529s21c1
Sequence:CCGGGCCGTGTGTCTTGCATAATTCCTCGAGGAATTATGCAAGACACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-369s1c1
Sequence:CCGGGATTGCAACTATCATGGTGCTCTCGAGAGCACCATGATAGTTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-347s1c1
Sequence:CCGGGAATGTTTGAGCCTACTCGTTCTCGAGAACGAGTAGGCTCAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-145s1c1
Sequence:CCGGGCATCTTCATTAAGCTGGAGTCTCGAGACTCCAGCTTAATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199344.1-849s1c1
Sequence:CCGGCCTATTCAGCAACAGCACATACTCGAGTATGTGCTGTTGCTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_199344.1-688s1c1
Sequence:CCGGCGAACATTTGAGGGTTACTTTCTCGAGAAAGTAACCCTCAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199344.1-149s1c1
Sequence:CCGGCTTCATTAAGCTGGAGTACCACTCGAGTGGTACTCCAGCTTAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145512
SFT2D2 MISSION shRNA Bacterial Glycerol Stock
SFT2 domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145512.4-3165s21c1
Sequence:CCGGTCCTACCAAGCCAGTAGTATTCTCGAGAATACTACTGGCTTGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-490s21c1
Sequence:CCGGATAAGGGACTTGCACTCATCTCTCGAGAGATGAGTGCAAGTCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-420s21c1
Sequence:CCGGACGCGTCTCATCGCCACAATTCTCGAGAATTGTGGCGATGAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-527s21c1
Sequence:CCGGTTTGGCCTTGACGTGGTATAGCTCGAGCTATACCACGTCAAGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-342s21c1
Sequence:CCGGCTGGGTAACATCATGTCAATTCTCGAGAATTGACATGATGTTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145512
SFT2D2 MISSION shRNA shRNA Plasmid DNA
SFT2 domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145512.4-3165s21c1
Sequence:CCGGTCCTACCAAGCCAGTAGTATTCTCGAGAATACTACTGGCTTGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-490s21c1
Sequence:CCGGATAAGGGACTTGCACTCATCTCTCGAGAGATGAGTGCAAGTCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-420s21c1
Sequence:CCGGACGCGTCTCATCGCCACAATTCTCGAGAATTGTGGCGATGAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-527s21c1
Sequence:CCGGTTTGGCCTTGACGTGGTATAGCTCGAGCTATACCACGTCAAGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-342s21c1
Sequence:CCGGCTGGGTAACATCATGTCAATTCTCGAGAATTGACATGATGTTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145512
SFT2D2 MISSION shRNA Lentiviral Transduction Particles
SFT2 domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145512.4-3165s21c1
Sequence:CCGGTCCTACCAAGCCAGTAGTATTCTCGAGAATACTACTGGCTTGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-490s21c1
Sequence:CCGGATAAGGGACTTGCACTCATCTCTCGAGAGATGAGTGCAAGTCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-420s21c1
Sequence:CCGGACGCGTCTCATCGCCACAATTCTCGAGAATTGTGGCGATGAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-527s21c1
Sequence:CCGGTTTGGCCTTGACGTGGTATAGCTCGAGCTATACCACGTCAAGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145512.4-342s21c1
Sequence:CCGGCTGGGTAACATCATGTCAATTCTCGAGAATTGACATGATGTTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks