EMAIL THIS PAGE TO A FRIEND

SFT2D3

SFT2 domain containing 3

UniProtKB ID: Q587I9, Q8N2P9
Gene ID:
Mouse(67158) SFT2 domain containing 3
Rat(364835) SFT2 domain containing 3
Zebrafish(407688) SFT2 domain containing 3
naked mole-rat(101701758) SFT2 domain containing 3
domestic guinea pig(100719556) SFT2 domain containing 3
cow(514114) SFT2 domain containing 3
sheep(101108631) SFT2 domain containing 3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301130 ANTI-SFT2D3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2107559 Anti-SFT2D3 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032740 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150351 MISSION® esiRNA esiRNA human SFT2D3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032740 Rosetta Predictions human pricing
NM_001108887 Rosetta Predictions rat pricing
XM_484715 Rosetta Predictions mouse pricing
XM_907118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084709 predicted 1414
2 SASI_Hs01_00084710 predicted 1630
3 SASI_Hs01_00084713 predicted 1263
4 SASI_Hs02_00360287 predicted 1654
5 SASI_Hs01_00084712 predicted 1425
6 SASI_Hs01_00084714 predicted 1585
7 SASI_Hs01_00084716 predicted 1326
8 SASI_Hs01_00084718 predicted 1405
9 SASI_Hs02_00360288 predicted 1605
10 SASI_Hs02_00360289 predicted 1619
11 SASI_Hs01_00084711 predicted 1494
12 SASI_Hs01_00084715 predicted 1595
13 SASI_Hs01_00084717 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243065 predicted 1023
2 SASI_Rn02_00243066 predicted 833
3 SASI_Rn02_00243067 predicted 909
4 SASI_Rn02_00243068 predicted 1135
5 SASI_Rn02_00243069 predicted 752
6 SASI_Rn02_00243070 predicted 1084
7 SASI_Rn02_00243071 predicted 1010
8 SASI_Rn02_00243072 predicted 1106
9 SASI_Rn02_00243073 predicted 883
10 SASI_Rn02_00243074 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217206 predicted 1474
2 SASI_Mm01_00217207 predicted 1746
3 SASI_Mm01_00217208 predicted 1648
4 SASI_Mm01_00217209 predicted 1753
5 SASI_Mm01_00217210 predicted 1722
6 SASI_Mm01_00217211 predicted 1466
7 SASI_Mm01_00217212 predicted 1790
8 SASI_Mm01_00217213 predicted 1072
9 SASI_Mm01_00217214 predicted 793
10 SASI_Mm02_00426524 predicted 1138
11 SASI_Mm01_00217205 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433073 predicted 1471
2 SASI_Mm02_00433074 predicted 1744
3 SASI_Mm02_00433075 predicted 1650
4 SASI_Mm02_00433076 predicted 1758
5 SASI_Mm02_00433077 predicted 1728
6 SASI_Mm02_00433078 predicted 1462
7 SASI_Mm02_00433079 predicted 1793
8 SASI_Mm02_00433080 predicted 1065
9 SASI_Mm02_00433081 predicted 792
10 SASI_Mm02_00433082 predicted 1136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032740
VALIDATED
SFT2D3 MISSION shRNA Bacterial Glycerol Stock
SFT2 domain containing 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032740.3-1938s1c1
Sequence:CCGGCTCGAATTATTCCTCATTGTACTCGAGTACAATGAGGAATAATTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032740.3-1927s21c1
Sequence:CCGGATTTCTACAAGCTCGAATTATCTCGAGATAATTCGAGCTTGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1848s21c1
Sequence:CCGGCTTAACGGTCTCTTCGGAAATCTCGAGATTTCCGAAGAGACCGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1409s21c1
Sequence:CCGGCAGGATGTGAGACGGTTATTACTCGAGTAATAACCGTCTCACATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1270s21c1
Sequence:CCGGCTAACAGCCTGCGAGTCTAATCTCGAGATTAGACTCGCAGGCTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1883s21c1
Sequence:CCGGGATAATTCTAGATCCGGAATACTCGAGTATTCCGGATCTAGAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032740
VALIDATED
SFT2D3 MISSION shRNA shRNA Plasmid DNA
SFT2 domain containing 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032740.3-1938s1c1
Sequence:CCGGCTCGAATTATTCCTCATTGTACTCGAGTACAATGAGGAATAATTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032740.3-1927s21c1
Sequence:CCGGATTTCTACAAGCTCGAATTATCTCGAGATAATTCGAGCTTGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1848s21c1
Sequence:CCGGCTTAACGGTCTCTTCGGAAATCTCGAGATTTCCGAAGAGACCGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1409s21c1
Sequence:CCGGCAGGATGTGAGACGGTTATTACTCGAGTAATAACCGTCTCACATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1270s21c1
Sequence:CCGGCTAACAGCCTGCGAGTCTAATCTCGAGATTAGACTCGCAGGCTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1883s21c1
Sequence:CCGGGATAATTCTAGATCCGGAATACTCGAGTATTCCGGATCTAGAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032740
VALIDATED
SFT2D3 MISSION shRNA Lentiviral Transduction Particles
SFT2 domain containing 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032740.3-1938s1c1
Sequence:CCGGCTCGAATTATTCCTCATTGTACTCGAGTACAATGAGGAATAATTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032740.3-1927s21c1
Sequence:CCGGATTTCTACAAGCTCGAATTATCTCGAGATAATTCGAGCTTGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1848s21c1
Sequence:CCGGCTTAACGGTCTCTTCGGAAATCTCGAGATTTCCGAAGAGACCGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1409s21c1
Sequence:CCGGCAGGATGTGAGACGGTTATTACTCGAGTAATAACCGTCTCACATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1270s21c1
Sequence:CCGGCTAACAGCCTGCGAGTCTAATCTCGAGATTAGACTCGCAGGCTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032740.3-1883s21c1
Sequence:CCGGGATAATTCTAGATCCGGAATACTCGAGTATTCCGGATCTAGAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026006
SFT2D3 MISSION shRNA Bacterial Glycerol Stock
SFT2 domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1452s21c1
Sequence:CCGGAGATCCTTTGGCTTCAGTATTCTCGAGAATACTGAAGCCAAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1636s21c1
Sequence:CCGGGAACTACATTCTACGTTAAAGCTCGAGCTTTAACGTAGAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1730s21c1
Sequence:CCGGGCAATCCAGATTATCAGATTACTCGAGTAATCTGATAATCTGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1603s21c1
Sequence:CCGGACGAATAGCTTTCTGACTTAGCTCGAGCTAAGTCAGAAAGCTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1693s21c1
Sequence:CCGGGCTTTCCAGACCCTCCTTATTCTCGAGAATAAGGAGGGTCTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026006
SFT2D3 MISSION shRNA shRNA Plasmid DNA
SFT2 domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1452s21c1
Sequence:CCGGAGATCCTTTGGCTTCAGTATTCTCGAGAATACTGAAGCCAAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1636s21c1
Sequence:CCGGGAACTACATTCTACGTTAAAGCTCGAGCTTTAACGTAGAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1730s21c1
Sequence:CCGGGCAATCCAGATTATCAGATTACTCGAGTAATCTGATAATCTGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1603s21c1
Sequence:CCGGACGAATAGCTTTCTGACTTAGCTCGAGCTAAGTCAGAAAGCTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1693s21c1
Sequence:CCGGGCTTTCCAGACCCTCCTTATTCTCGAGAATAAGGAGGGTCTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026006
SFT2D3 MISSION shRNA Lentiviral Transduction Particles
SFT2 domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1452s21c1
Sequence:CCGGAGATCCTTTGGCTTCAGTATTCTCGAGAATACTGAAGCCAAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1636s21c1
Sequence:CCGGGAACTACATTCTACGTTAAAGCTCGAGCTTTAACGTAGAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1730s21c1
Sequence:CCGGGCAATCCAGATTATCAGATTACTCGAGTAATCTGATAATCTGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1603s21c1
Sequence:CCGGACGAATAGCTTTCTGACTTAGCTCGAGCTAAGTCAGAAAGCTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026006.1-1693s21c1
Sequence:CCGGGCTTTCCAGACCCTCCTTATTCTCGAGAATAAGGAGGGTCTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks