EMAIL THIS PAGE TO A FRIEND

SFXN5

sideroflexin 5

Synonyms: BBG-TCC
UniProtKB ID: Q8TD22, A8K116, Q494Y3, Q53T29
Gene ID:
Mouse(94282) sideroflexin 5
Rat(261737) sideroflexin 5
chicken(422954) sideroflexin 5
dog(612350) sideroflexin 5
domestic cat(101101458) sideroflexin 5
naked mole-rat(101710443) sideroflexin 5
cow(528468) sideroflexin 5
sheep(101111700) sideroflexin 5
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144579 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050031 MISSION® esiRNA esiRNA human SFXN5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144579 Rosetta Predictions human pricing
NM_153298 Rosetta Predictions rat pricing
NM_178639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140177 predicted 517
2 SASI_Hs01_00140178 predicted 596
3 SASI_Hs01_00140179 predicted 1056
4 SASI_Hs01_00140180 predicted 1050
5 SASI_Hs01_00140181 predicted 440
6 SASI_Hs01_00140182 predicted 578
7 SASI_Hs01_00140183 predicted 1068
8 SASI_Hs01_00140184 predicted 551
9 SASI_Hs01_00140185 predicted 634
10 SASI_Hs01_00140186 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268943 predicted 624
2 SASI_Rn01_00102946 predicted 286
3 SASI_Rn01_00102947 predicted 354
4 SASI_Rn01_00102948 predicted 390
5 SASI_Rn01_00102949 predicted 194
6 SASI_Rn01_00102950 predicted 798
7 SASI_Rn01_00102951 predicted 256
8 SASI_Rn01_00102952 predicted 660
9 SASI_Rn01_00102953 predicted 663
10 SASI_Rn01_00102954 predicted 495
11 SASI_Rn01_00102955 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349027 predicted 788
2 SASI_Mm02_00349028 predicted 488
3 SASI_Mm02_00349029 predicted 320
4 SASI_Mm02_00349030 predicted 427
5 SASI_Mm02_00349031 predicted 361
6 SASI_Mm02_00349032 predicted 833
7 SASI_Mm02_00349033 predicted 959
8 SASI_Mm02_00349034 predicted 513
9 SASI_Mm02_00349035 predicted 326
10 SASI_Mm02_00349036 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178639
SFXN5 MISSION shRNA Bacterial Glycerol Stock
sideroflexin 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178639.2-3075s1c1
Sequence:CCGGCCATGCTGTTAAACCCTGTTTCTCGAGAAACAGGGTTTAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-560s1c1
Sequence:CCGGGCTGGTTCAGAAAGCAAACAACTCGAGTTGTTTGCTTTCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-605s1c1
Sequence:CCGGCGTGCAGAGATTTGTACCCTTCTCGAGAAGGGTACAAATCTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-237s1c1
Sequence:CCGGCGCCCAGGAGTTACAAATGAACTCGAGTTCATTTGTAACTCCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-326s1c1
Sequence:CCGGGCCTTTCAGAATGTCAGGTTACTCGAGTAACCTGACATTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-164s21c1
Sequence:CCGGCGAACACTCTTTGTCACTGAGCTCGAGCTCAGTGACAAAGAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-452s21c1
Sequence:CCGGGTCAACTATGCAAACCGCAATCTCGAGATTGCGGTTTGCATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-117s21c1
Sequence:CCGGCATCCTTCTACGGTCGCTTCACTCGAGTGAAGCGACCGTAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-138s21c1
Sequence:CCGGGGCACTTCTTGGACATCATCGCTCGAGCGATGATGTCCAAGAAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178639
SFXN5 MISSION shRNA shRNA Plasmid DNA
sideroflexin 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178639.2-3075s1c1
Sequence:CCGGCCATGCTGTTAAACCCTGTTTCTCGAGAAACAGGGTTTAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-560s1c1
Sequence:CCGGGCTGGTTCAGAAAGCAAACAACTCGAGTTGTTTGCTTTCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-605s1c1
Sequence:CCGGCGTGCAGAGATTTGTACCCTTCTCGAGAAGGGTACAAATCTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-237s1c1
Sequence:CCGGCGCCCAGGAGTTACAAATGAACTCGAGTTCATTTGTAACTCCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-326s1c1
Sequence:CCGGGCCTTTCAGAATGTCAGGTTACTCGAGTAACCTGACATTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-164s21c1
Sequence:CCGGCGAACACTCTTTGTCACTGAGCTCGAGCTCAGTGACAAAGAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-452s21c1
Sequence:CCGGGTCAACTATGCAAACCGCAATCTCGAGATTGCGGTTTGCATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-117s21c1
Sequence:CCGGCATCCTTCTACGGTCGCTTCACTCGAGTGAAGCGACCGTAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-138s21c1
Sequence:CCGGGGCACTTCTTGGACATCATCGCTCGAGCGATGATGTCCAAGAAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178639
SFXN5 MISSION shRNA Lentiviral Transduction Particles
sideroflexin 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178639.2-3075s1c1
Sequence:CCGGCCATGCTGTTAAACCCTGTTTCTCGAGAAACAGGGTTTAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-560s1c1
Sequence:CCGGGCTGGTTCAGAAAGCAAACAACTCGAGTTGTTTGCTTTCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-605s1c1
Sequence:CCGGCGTGCAGAGATTTGTACCCTTCTCGAGAAGGGTACAAATCTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-237s1c1
Sequence:CCGGCGCCCAGGAGTTACAAATGAACTCGAGTTCATTTGTAACTCCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178639.2-326s1c1
Sequence:CCGGGCCTTTCAGAATGTCAGGTTACTCGAGTAACCTGACATTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-164s21c1
Sequence:CCGGCGAACACTCTTTGTCACTGAGCTCGAGCTCAGTGACAAAGAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-452s21c1
Sequence:CCGGGTCAACTATGCAAACCGCAATCTCGAGATTGCGGTTTGCATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-117s21c1
Sequence:CCGGCATCCTTCTACGGTCGCTTCACTCGAGTGAAGCGACCGTAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178639.4-138s21c1
Sequence:CCGGGGCACTTCTTGGACATCATCGCTCGAGCGATGATGTCCAAGAAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144579
VALIDATED
SFXN5 MISSION shRNA Bacterial Glycerol Stock
sideroflexin 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-450s1c1
Sequence:CCGGGCCATTTAGAATGTCAGGTTACTCGAGTAACCTGACATTCTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-574s1c1
Sequence:CCGGGTCAACTATGCAAACCGCAATCTCGAGATTGCGGTTTGCATAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-1090s1c1
Sequence:CCGGTCCCAATTAGAGCCGGAGATACTCGAGTATCTCCGGCTCTAATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-255s1c1
Sequence:CCGGCTTCAGGCACTTCTTGGATATCTCGAGATATCCAAGAAGTGCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-676s1c1
Sequence:CCGGCTTAATGTCCTGGTTCAGAAACTCGAGTTTCTGAACCAGGACATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144579.2-1518s21c1
Sequence:CCGGTCAAATCTGAGCCTTAGTTTCCTCGAGGAAACTAAGGCTCAGATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-482s21c1
Sequence:CCGGGCCAATTGTAGTCGGTCTTCTCTCGAGAGAAGACCGACTACAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-751s21c1
Sequence:CCGGCTGTAGCCAGTGCCAATATCTCTCGAGAGATATTGGCACTGGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-599s21c1
Sequence:CCGGGCCTTCACCTGCATCCAAGTTCTCGAGAACTTGGATGCAGGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-799s21c1
Sequence:CCGGAGCTGGAGGAAGGGATTGATGCTCGAGCATCAATCCCTTCCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144579
VALIDATED
SFXN5 MISSION shRNA shRNA Plasmid DNA
sideroflexin 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-450s1c1
Sequence:CCGGGCCATTTAGAATGTCAGGTTACTCGAGTAACCTGACATTCTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-574s1c1
Sequence:CCGGGTCAACTATGCAAACCGCAATCTCGAGATTGCGGTTTGCATAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-1090s1c1
Sequence:CCGGTCCCAATTAGAGCCGGAGATACTCGAGTATCTCCGGCTCTAATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-255s1c1
Sequence:CCGGCTTCAGGCACTTCTTGGATATCTCGAGATATCCAAGAAGTGCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-676s1c1
Sequence:CCGGCTTAATGTCCTGGTTCAGAAACTCGAGTTTCTGAACCAGGACATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144579.2-1518s21c1
Sequence:CCGGTCAAATCTGAGCCTTAGTTTCCTCGAGGAAACTAAGGCTCAGATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-482s21c1
Sequence:CCGGGCCAATTGTAGTCGGTCTTCTCTCGAGAGAAGACCGACTACAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-751s21c1
Sequence:CCGGCTGTAGCCAGTGCCAATATCTCTCGAGAGATATTGGCACTGGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-599s21c1
Sequence:CCGGGCCTTCACCTGCATCCAAGTTCTCGAGAACTTGGATGCAGGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-799s21c1
Sequence:CCGGAGCTGGAGGAAGGGATTGATGCTCGAGCATCAATCCCTTCCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144579
VALIDATED
SFXN5 MISSION shRNA Lentiviral Transduction Particles
sideroflexin 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-450s1c1
Sequence:CCGGGCCATTTAGAATGTCAGGTTACTCGAGTAACCTGACATTCTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-574s1c1
Sequence:CCGGGTCAACTATGCAAACCGCAATCTCGAGATTGCGGTTTGCATAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-1090s1c1
Sequence:CCGGTCCCAATTAGAGCCGGAGATACTCGAGTATCTCCGGCTCTAATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-255s1c1
Sequence:CCGGCTTCAGGCACTTCTTGGATATCTCGAGATATCCAAGAAGTGCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_144579.1-676s1c1
Sequence:CCGGCTTAATGTCCTGGTTCAGAAACTCGAGTTTCTGAACCAGGACATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144579.2-1518s21c1
Sequence:CCGGTCAAATCTGAGCCTTAGTTTCCTCGAGGAAACTAAGGCTCAGATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-482s21c1
Sequence:CCGGGCCAATTGTAGTCGGTCTTCTCTCGAGAGAAGACCGACTACAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-751s21c1
Sequence:CCGGCTGTAGCCAGTGCCAATATCTCTCGAGAGATATTGGCACTGGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-599s21c1
Sequence:CCGGGCCTTCACCTGCATCCAAGTTCTCGAGAACTTGGATGCAGGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144579.2-799s21c1
Sequence:CCGGAGCTGGAGGAAGGGATTGATGCTCGAGCATCAATCCCTTCCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks