EMAIL THIS PAGE TO A FRIEND

SGCE

sarcoglycan, epsilon

Synonyms: DYT11 ESG
Gene ID:
Human(8910) Summary: This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Mouse(20392) sarcoglycan, epsilon
Rat(432360) sarcoglycan, epsilon
domestic guinea pig(100719995) sarcoglycan, epsilon
naked mole-rat(101723078) sarcoglycan, epsilon
Domestic Rabbit(100352334) sarcoglycan, epsilon
cow(407209) sarcoglycan, epsilon
sheep(101115114) sarcoglycan, epsilon
Zebrafish(368230) sarcoglycan, epsilon
chicken(420567) sarcoglycan, epsilon
dog(475233) sarcoglycan, epsilon
Horse(100051775) sarcoglycan, epsilon
domestic cat(101089844) sarcoglycan, epsilon
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003919 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042671 MISSION® esiRNA esiRNA human SGCE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099400 Rosetta Predictions human pricing
NM_001099401 Rosetta Predictions human pricing
NM_003919 Rosetta Predictions human pricing
NM_001002023 Rosetta Predictions rat pricing
NM_001130188 Rosetta Predictions mouse pricing
NM_001130189 Rosetta Predictions mouse pricing
NM_001130190 Rosetta Predictions mouse pricing
NM_001130191 Rosetta Predictions mouse pricing
NM_011360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320529 predicted 850
2 SASI_Hs02_00320530 predicted 649
3 SASI_Hs02_00320531 predicted 430
4 SASI_Hs02_00320532 predicted 837
5 SASI_Hs02_00320533 predicted 861
6 SASI_Hs02_00320534 predicted 833
7 SASI_Hs02_00320535 predicted 745
8 SASI_Hs02_00320536 predicted 643
9 SASI_Hs02_00320537 predicted 507
10 SASI_Hs02_00320538 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320539 predicted 855
2 SASI_Hs02_00320540 predicted 654
3 SASI_Hs02_00320541 predicted 432
4 SASI_Hs02_00320542 predicted 837
5 SASI_Hs02_00320543 predicted 854
6 SASI_Hs02_00320544 predicted 835
7 SASI_Hs02_00320545 predicted 747
8 SASI_Hs02_00320546 predicted 643
9 SASI_Hs02_00320547 predicted 500
10 SASI_Hs02_00320548 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028401 predicted 848
2 SASI_Hs02_00336564 predicted 654
3 SASI_Hs01_00028402 predicted 430
4 SASI_Hs01_00028404 predicted 830
5 SASI_Hs01_00028406 predicted 853
6 SASI_Hs02_00336565 predicted 831
7 SASI_Hs02_00336566 predicted 746
8 SASI_Hs02_00336567 predicted 644
9 SASI_Hs02_00336568 predicted 502
10 SASI_Hs01_00028397 predicted 645
11 SASI_Hs01_00028398 predicted 1363
12 SASI_Hs01_00028399 predicted 553
13 SASI_Hs01_00028400 predicted 1396
14 SASI_Hs01_00028403 predicted 542
15 SASI_Hs01_00028405 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077270 predicted 798
2 SASI_Rn01_00077271 predicted 681
3 SASI_Rn01_00077272 predicted 469
4 SASI_Rn01_00077273 predicted 787
5 SASI_Rn01_00077274 predicted 965
6 SASI_Rn01_00077275 predicted 513
7 SASI_Rn01_00077276 predicted 413
8 SASI_Rn01_00077277 predicted 1029
9 SASI_Rn02_00197959 predicted 876
10 SASI_Rn02_00197960 predicted 604
11 SASI_Rn01_00077268 predicted 292
12 SASI_Rn01_00077269 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311088 predicted 962
2 SASI_Mm02_00311089 predicted 1016
3 SASI_Mm02_00311090 predicted 1039
4 SASI_Mm02_00311091 predicted 1011
5 SASI_Mm02_00311092 predicted 691
6 SASI_Mm02_00311093 predicted 641
7 SASI_Mm02_00311094 predicted 870
8 SASI_Mm02_00311095 predicted 975
9 SASI_Mm02_00311096 predicted 593
10 SASI_Mm02_00311097 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311098 predicted 860
2 SASI_Mm02_00311099 predicted 908
3 SASI_Mm02_00311100 predicted 929
4 SASI_Mm02_00311101 predicted 901
5 SASI_Mm02_00311102 predicted 591
6 SASI_Mm02_00311103 predicted 540
7 SASI_Mm02_00311104 predicted 761
8 SASI_Mm02_00311105 predicted 870
9 SASI_Mm02_00311106 predicted 483
10 SASI_Mm02_00311107 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311108 predicted 855
2 SASI_Mm02_00311109 predicted 905
3 SASI_Mm02_00311110 predicted 931
4 SASI_Mm02_00311111 predicted 897
5 SASI_Mm02_00311112 predicted 582
6 SASI_Mm02_00311113 predicted 531
7 SASI_Mm02_00311114 predicted 758
8 SASI_Mm02_00311115 predicted 870
9 SASI_Mm02_00311116 predicted 487
10 SASI_Mm02_00311117 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311118 predicted 856
2 SASI_Mm02_00311119 predicted 911
3 SASI_Mm02_00311120 predicted 925
4 SASI_Mm02_00311121 predicted 899
5 SASI_Mm02_00311122 predicted 590
6 SASI_Mm02_00311123 predicted 536
7 SASI_Mm02_00311124 predicted 757
8 SASI_Mm02_00311125 predicted 875
9 SASI_Mm02_00311126 predicted 485
10 SASI_Mm02_00311127 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042405 predicted 857
2 SASI_Mm01_00042406 predicted 910
3 SASI_Mm02_00320515 predicted 922
4 SASI_Mm01_00042409 predicted 894
5 SASI_Mm01_00042410 predicted 583
6 SASI_Mm02_00320516 predicted 532
7 SASI_Mm01_00042411 predicted 763
8 SASI_Mm01_00042412 predicted 868
9 SASI_Mm01_00042413 predicted 482
10 SASI_Mm02_00320517 predicted 637
11 SASI_Mm01_00042407 predicted 1023
12 SASI_Mm01_00042408 predicted 950
13 SASI_Mm01_00042414 predicted 776
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011360
VALIDATED
SGCE MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, epsilon
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000119307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-1447s1c1
Sequence:CCGGCCCACTGTGTTGAGAACCAAACTCGAGTTTGGTTCTCAACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-419s1c1
Sequence:CCGGGCCTACAATAGACGTACCTTTCTCGAGAAAGGTACGTCTATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-781s1c1
Sequence:CCGGGCCTGTGATAACATGCGACAACTCGAGTTGTCGCATGTTATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-951s1c1
Sequence:CCGGGCCGAGACTATTACACGGATTCTCGAGAATCCGTGTAATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011360
VALIDATED
SGCE MISSION shRNA shRNA Plasmid DNA
sarcoglycan, epsilon
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000119307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-1447s1c1
Sequence:CCGGCCCACTGTGTTGAGAACCAAACTCGAGTTTGGTTCTCAACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-419s1c1
Sequence:CCGGGCCTACAATAGACGTACCTTTCTCGAGAAAGGTACGTCTATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-781s1c1
Sequence:CCGGGCCTGTGATAACATGCGACAACTCGAGTTGTCGCATGTTATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-951s1c1
Sequence:CCGGGCCGAGACTATTACACGGATTCTCGAGAATCCGTGTAATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011360
VALIDATED
SGCE MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, epsilon
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000119307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-1447s1c1
Sequence:CCGGCCCACTGTGTTGAGAACCAAACTCGAGTTTGGTTCTCAACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-419s1c1
Sequence:CCGGGCCTACAATAGACGTACCTTTCTCGAGAAAGGTACGTCTATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-781s1c1
Sequence:CCGGGCCTGTGATAACATGCGACAACTCGAGTTGTCGCATGTTATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011360.2-951s1c1
Sequence:CCGGGCCGAGACTATTACACGGATTCTCGAGAATCCGTGTAATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003919
SGCE MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, epsilon
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-538s1c1
Sequence:CCGGCGTTGCCATATCAAGCAGAATCTCGAGATTCTGCTTGATATGGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-1349s1c1
Sequence:CCGGCCAACAGCAGACTACAGGTAACTCGAGTTACCTGTAGTCTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-827s1c1
Sequence:CCGGGCCTGTAATAACATGTGATAACTCGAGTTATCACATGTTATTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-997s1c1
Sequence:CCGGGCAGAGACTATTACACGGATTCTCGAGAATCCGTGTAATAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-297s1c1
Sequence:CCGGCCTGGCGAGATTAGTAATGATCTCGAGATCATTACTAATCTCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003919.2-528s21c1
Sequence:CCGGTGAGACTGCAAGGCATAATTTCTCGAGAAATTATGCCTTGCAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003919.2-402s21c1
Sequence:CCGGACCTGGATGGCTTCGATATATCTCGAGATATATCGAAGCCATCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003919
SGCE MISSION shRNA shRNA Plasmid DNA
sarcoglycan, epsilon
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-538s1c1
Sequence:CCGGCGTTGCCATATCAAGCAGAATCTCGAGATTCTGCTTGATATGGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-1349s1c1
Sequence:CCGGCCAACAGCAGACTACAGGTAACTCGAGTTACCTGTAGTCTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-827s1c1
Sequence:CCGGGCCTGTAATAACATGTGATAACTCGAGTTATCACATGTTATTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-997s1c1
Sequence:CCGGGCAGAGACTATTACACGGATTCTCGAGAATCCGTGTAATAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-297s1c1
Sequence:CCGGCCTGGCGAGATTAGTAATGATCTCGAGATCATTACTAATCTCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003919.2-528s21c1
Sequence:CCGGTGAGACTGCAAGGCATAATTTCTCGAGAAATTATGCCTTGCAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003919.2-402s21c1
Sequence:CCGGACCTGGATGGCTTCGATATATCTCGAGATATATCGAAGCCATCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003919
SGCE MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, epsilon
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-538s1c1
Sequence:CCGGCGTTGCCATATCAAGCAGAATCTCGAGATTCTGCTTGATATGGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-1349s1c1
Sequence:CCGGCCAACAGCAGACTACAGGTAACTCGAGTTACCTGTAGTCTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-827s1c1
Sequence:CCGGGCCTGTAATAACATGTGATAACTCGAGTTATCACATGTTATTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-997s1c1
Sequence:CCGGGCAGAGACTATTACACGGATTCTCGAGAATCCGTGTAATAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003919.1-297s1c1
Sequence:CCGGCCTGGCGAGATTAGTAATGATCTCGAGATCATTACTAATCTCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003919.2-528s21c1
Sequence:CCGGTGAGACTGCAAGGCATAATTTCTCGAGAAATTATGCCTTGCAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003919.2-402s21c1
Sequence:CCGGACCTGGATGGCTTCGATATATCTCGAGATATATCGAAGCCATCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks