EMAIL THIS PAGE TO A FRIEND

SGK494

UniProtKB ID: Q96LW2, B4DFP4, Q49A48
Gene ID:
Rat(685208) uncharacterized serine/threonine-protein kinase SgK494
cow(527796) uncharacterized serine/threonine-protein kinase SgK494-like
dog(610931) uncharacterized serine/threonine-protein kinase SgK494
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144610 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015571 MISSION® esiRNA esiRNA targeting human FLJ25006 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144610 Rosetta Predictions human pricing
XM_001062816 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133315 predicted 401
2 SASI_Hs02_00364421 predicted 423
3 SASI_Hs01_00133317 predicted 585
4 SASI_Hs01_00133318 predicted 367
5 SASI_Hs01_00133319 predicted 473
6 SASI_Hs02_00364422 predicted 411
7 SASI_Hs01_00133320 predicted 497
8 SASI_Hs01_00133321 predicted 512
9 SASI_Hs01_00133322 predicted 581
10 SASI_Hs01_00133323 predicted 440
11 SASI_Hs01_00133314 predicted 292
12 SASI_Hs01_00133316 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304727 predicted 577
2 SASI_Rn02_00304728 predicted 533
3 SASI_Rn02_00304729 predicted 487
4 SASI_Rn02_00304730 predicted 611
5 SASI_Rn02_00304731 predicted 352
6 SASI_Rn02_00304732 predicted 640
7 SASI_Rn02_00304733 predicted 257
8 SASI_Rn02_00304734 predicted 283
9 SASI_Rn02_00304735 predicted 414
10 SASI_Rn02_00304736 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144610
SGK494 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144610.1-146s1c1
Sequence:CCGGGAAGAGCCTCTGGACAGGTTTCTCGAGAAACCTGTCCAGAGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-595s1c1
Sequence:CCGGGCACAGATCTGTACTCCCTTTCTCGAGAAAGGGAGTACAGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.1-1207s1c1
Sequence:CCGGGTACTGATACTAGACCATTTACTCGAGTAAATGGTCTAGTATCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.1-1173s1c1
Sequence:CCGGCACTAAATATTCAGCTGATTGCTCGAGCAATCAGCTGAATATTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144610.1-831s1c1
Sequence:CCGGCTTCAGTACATGGGTGAGAGACTCGAGTCTCTCACCCATGTACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-448s1c1
Sequence:CCGGCCAAGGTAAAGGTCCTACAGACTCGAGTCTGTAGGACCTTTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-510s1c1
Sequence:CCGGCGACAGATCAACCATCCCTTTCTCGAGAAAGGGATGGTTGATCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-715s1c1
Sequence:CCGGGAGATGTGAAGATGGAGAATACTCGAGTATTCTCCATCTTCACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-315s1c1
Sequence:CCGGGAGTTTCCCATTAGGCCCATTCTCGAGAATGGGCCTAATGGGAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.x-1040s1c1
Sequence:CCGGTAATTGCTGTGGATACTGTAACTCGAGTTACAGTATCCACAGCAATTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-316s1c1
Sequence:CCGGAGTTTCCCATTAGGCCCATTACTCGAGTAATGGGCCTAATGGGAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144610
SGK494 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144610.1-146s1c1
Sequence:CCGGGAAGAGCCTCTGGACAGGTTTCTCGAGAAACCTGTCCAGAGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-595s1c1
Sequence:CCGGGCACAGATCTGTACTCCCTTTCTCGAGAAAGGGAGTACAGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.1-1207s1c1
Sequence:CCGGGTACTGATACTAGACCATTTACTCGAGTAAATGGTCTAGTATCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.1-1173s1c1
Sequence:CCGGCACTAAATATTCAGCTGATTGCTCGAGCAATCAGCTGAATATTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144610.1-831s1c1
Sequence:CCGGCTTCAGTACATGGGTGAGAGACTCGAGTCTCTCACCCATGTACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-448s1c1
Sequence:CCGGCCAAGGTAAAGGTCCTACAGACTCGAGTCTGTAGGACCTTTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-510s1c1
Sequence:CCGGCGACAGATCAACCATCCCTTTCTCGAGAAAGGGATGGTTGATCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-715s1c1
Sequence:CCGGGAGATGTGAAGATGGAGAATACTCGAGTATTCTCCATCTTCACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-315s1c1
Sequence:CCGGGAGTTTCCCATTAGGCCCATTCTCGAGAATGGGCCTAATGGGAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.x-1040s1c1
Sequence:CCGGTAATTGCTGTGGATACTGTAACTCGAGTTACAGTATCCACAGCAATTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-316s1c1
Sequence:CCGGAGTTTCCCATTAGGCCCATTACTCGAGTAATGGGCCTAATGGGAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144610
SGK494 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144610.1-146s1c1
Sequence:CCGGGAAGAGCCTCTGGACAGGTTTCTCGAGAAACCTGTCCAGAGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-595s1c1
Sequence:CCGGGCACAGATCTGTACTCCCTTTCTCGAGAAAGGGAGTACAGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.1-1207s1c1
Sequence:CCGGGTACTGATACTAGACCATTTACTCGAGTAAATGGTCTAGTATCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.1-1173s1c1
Sequence:CCGGCACTAAATATTCAGCTGATTGCTCGAGCAATCAGCTGAATATTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144610.1-831s1c1
Sequence:CCGGCTTCAGTACATGGGTGAGAGACTCGAGTCTCTCACCCATGTACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-448s1c1
Sequence:CCGGCCAAGGTAAAGGTCCTACAGACTCGAGTCTGTAGGACCTTTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.1-510s1c1
Sequence:CCGGCGACAGATCAACCATCCCTTTCTCGAGAAAGGGATGGTTGATCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-715s1c1
Sequence:CCGGGAGATGTGAAGATGGAGAATACTCGAGTATTCTCCATCTTCACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-315s1c1
Sequence:CCGGGAGTTTCCCATTAGGCCCATTCTCGAGAATGGGCCTAATGGGAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144610.x-1040s1c1
Sequence:CCGGTAATTGCTGTGGATACTGTAACTCGAGTTACAGTATCCACAGCAATTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144610.x-316s1c1
Sequence:CCGGAGTTTCCCATTAGGCCCATTACTCGAGTAATGGGCCTAATGGGAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks