EMAIL THIS PAGE TO A FRIEND

SH2D3A

SH2 domain containing 3A

Synonyms: NSP1
UniProtKB ID: Q9BRG2, A8K9R6, Q9Y2X4
Gene ID:
Horse(100065982) SH2 domain containing 3A
dog(485017) SH2 domain containing 3A
domestic cat(101088987) SH2 domain containing 3A
cow(510173) SH2 domain containing 3A
sheep(101107599) SH2 domain containing 3A
naked mole-rat(101700027) SH2 domain containing 3A
domestic guinea pig(100713496) SH2 domain containing 3A
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005490 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155561 MISSION® esiRNA esiRNA human SH2D3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005490 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120562 predicted 414
2 SASI_Hs01_00120563 predicted 420
3 SASI_Hs01_00120564 predicted 803
4 SASI_Hs01_00120565 predicted 417
5 SASI_Hs01_00120566 predicted 1392
6 SASI_Hs01_00120567 predicted 1061
7 SASI_Hs01_00120569 predicted 368
8 SASI_Hs01_00120570 predicted 935
9 SASI_Hs01_00120571 predicted 219
10 SASI_Hs01_00120568 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005490
SH2D3A MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 3A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005490.1-2083s1c1
Sequence:CCGGCAAATGTGACTCCACCTCTTACTCGAGTAAGAGGTGGAGTCACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-595s1c1
Sequence:CCGGGCCTGCAGATTTGGCACATATCTCGAGATATGTGCCAAATCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-594s1c1
Sequence:CCGGAGCCTGCAGATTTGGCACATACTCGAGTATGTGCCAAATCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-417s1c1
Sequence:CCGGCGGCTCTGGTTCACAGTTATACTCGAGTATAACTGTGAACCAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-1813s1c1
Sequence:CCGGCGCTGAACGCTTTGAGAAGTTCTCGAGAACTTCTCAAAGCGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005490
SH2D3A MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 3A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005490.1-2083s1c1
Sequence:CCGGCAAATGTGACTCCACCTCTTACTCGAGTAAGAGGTGGAGTCACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-595s1c1
Sequence:CCGGGCCTGCAGATTTGGCACATATCTCGAGATATGTGCCAAATCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-594s1c1
Sequence:CCGGAGCCTGCAGATTTGGCACATACTCGAGTATGTGCCAAATCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-417s1c1
Sequence:CCGGCGGCTCTGGTTCACAGTTATACTCGAGTATAACTGTGAACCAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-1813s1c1
Sequence:CCGGCGCTGAACGCTTTGAGAAGTTCTCGAGAACTTCTCAAAGCGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005490
SH2D3A MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 3A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005490.1-2083s1c1
Sequence:CCGGCAAATGTGACTCCACCTCTTACTCGAGTAAGAGGTGGAGTCACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-595s1c1
Sequence:CCGGGCCTGCAGATTTGGCACATATCTCGAGATATGTGCCAAATCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-594s1c1
Sequence:CCGGAGCCTGCAGATTTGGCACATACTCGAGTATGTGCCAAATCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-417s1c1
Sequence:CCGGCGGCTCTGGTTCACAGTTATACTCGAGTATAACTGTGAACCAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005490.1-1813s1c1
Sequence:CCGGCGCTGAACGCTTTGAGAAGTTCTCGAGAACTTCTCAAAGCGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks