EMAIL THIS PAGE TO A FRIEND

SH3GLB1

SH3-domain GRB2-like endophilin B1

Synonyms: Bif-1 PPP1R70 dJ612B15.2
UniProtKB ID: Q9Y371, B4E182, Q5H8U5, Q9H3Z0, Q9NR47, Q9NYA9
Gene ID:
Human(51100) Summary: This gene encodes a SRC homology 3 domain-containing protein. The encoded protein interacts with the proapoptotic member of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be involved in regulating apoptotic signaling pathways. This protein may also be involved in maintaining mitochondrial morphology. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(54673) SH3-domain GRB2-like B1 (endophilin)
Rat(292156) SH3-domain GRB2-like endophilin B1
Zebrafish(334911) SH3-domain GRB2-like endophilin B1
chicken(424522) SH3-domain GRB2-like endophilin B1
Horse(100052441) SH3-domain GRB2-like endophilin B1
domestic cat(101101490) SH3-domain GRB2-like endophilin B1
dog(612505) SH3-domain GRB2-like endophilin B1
domestic guinea pig(100733841) SH3-domain GRB2-like endophilin B1
naked mole-rat(101708379) SH3-domain GRB2-like endophilin B1
cow(533918) SH3-domain GRB2-like endophilin B1
sheep(101116521) SH3-domain GRB2-like endophilin B1
217 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500303 Anti-Bif antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
B6562 Anti-Bif-1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
B6437 Anti-Bif-1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation, western blot pricing
SAB2500160 Anti-BIF-1/SH3GLB1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1306423 ANTI-ENDOPHILIN B1 (Y80) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305589 ANTI-PHOSPHO-ENDOPHILIN(Y80) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1105153 Anti-SH3GLB1 (191-204) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105152 Anti-SH3GLB1 (82-95) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA015608 Anti-SH3GLB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA019900 Anti-SH3GLB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunohistochemistry, western blot pricing
SAB2107351 Anti-SH3GLB1 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, horse, human
ELISA, western blot pricing
WH0051100M1 Monoclonal Anti-SH3GLB1 antibody produced in mouse clone 1B3-A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016009 Rosetta Predictions human pricing
NM_001011929 Rosetta Predictions rat pricing
XM_575053 Rosetta Predictions rat pricing
NM_019464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035656 predicted 529
2 SASI_Hs01_00035657 predicted 457
3 SASI_Hs01_00035658 predicted 1113
4 SASI_Hs01_00035659 predicted 1280
5 SASI_Hs01_00035661 predicted 732
6 SASI_Hs01_00035662 predicted 543
7 SASI_Hs01_00035663 predicted 1490
8 SASI_Hs01_00035664 predicted 1429
9 SASI_Hs01_00035665 predicted 1394
10 SASI_Hs02_00348688 predicted 443
11 SASI_Hs01_00035660 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062946 predicted 521
2 SASI_Rn01_00062947 predicted 731
3 SASI_Rn01_00062948 predicted 1196
4 SASI_Rn01_00062949 predicted 529
5 SASI_Rn01_00062951 predicted 1010
6 SASI_Rn01_00062952 predicted 1292
7 SASI_Rn01_00062953 predicted 981
8 SASI_Rn01_00062954 predicted 1092
9 SASI_Rn01_00062955 predicted 570
10 SASI_Rn02_00199933 predicted 1435
11 SASI_Rn01_00062950 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147448 predicted 520
2 SASI_Rn01_00147449 predicted 1456
3 SASI_Rn01_00147450 predicted 1503
4 SASI_Rn01_00147451 predicted 652
5 SASI_Rn01_00147452 predicted 1255
6 SASI_Rn01_00147453 predicted 1189
7 SASI_Rn01_00147454 predicted 535
8 SASI_Rn01_00147455 predicted 1529
9 SASI_Rn01_00147456 predicted 1505
10 SASI_Rn01_00147457 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022592 predicted 479
2 SASI_Mm02_00324456 predicted 1420
3 SASI_Mm01_00022593 predicted 1152
4 SASI_Mm01_00022594 predicted 689
5 SASI_Mm01_00022595 predicted 1346
6 SASI_Mm01_00022596 predicted 600
7 SASI_Mm01_00022597 predicted 485
8 SASI_Mm01_00022598 predicted 1425
9 SASI_Mm01_00022599 predicted 753
10 SASI_Mm01_00022601 predicted 435
11 SASI_Mm01_00022600 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019464
VALIDATED
SH3GLB1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like endophilin B1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1541s21c1
Sequence:GTACCGGCAGAATCTATGTTAGCGATTTCTCGAGAAATCGCTAACATAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019464.2-538s21c1
Sequence:CCGGCGTATAAACAACCCGGAACTTCTCGAGAAGTTCCGGGTTGTTTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1346s21c1
Sequence:CCGGCCTACTTAGAACTTCTCAATTCTCGAGAATTGAGAAGTTCTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-983s21c1
Sequence:CCGGATGCACAGTGTTACCAGTATACTCGAGTATACTGGTAACACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1390s21c1
Sequence:CCGGACCCATCACAACACCATATTTCTCGAGAAATATGGTGTTGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1418s21c1
Sequence:CCGGTAACTCTAAAGCAGGTTTAAACTCGAGTTTAAACCTGCTTTAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019464.1-2559s1c1
Sequence:CCGGGCGGAGTACAAAGGTGTAGTTCTCGAGAACTACACCTTTGTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-1346s1c1
Sequence:CCGGCCTACTTAGAACTTCTCAATTCTCGAGAATTGAGAAGTTCTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-538s1c1
Sequence:CCGGCGTATAAACAACCCGGAACTTCTCGAGAAGTTCCGGGTTGTTTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-605s1c1
Sequence:CCGGCAGCTTATGGAAATGCCCTTACTCGAGTAAGGGCATTTCCATAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-607s1c1
Sequence:CCGGGCTTATGGAAATGCCCTTATTCTCGAGAATAAGGGCATTTCCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019464
VALIDATED
SH3GLB1 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like endophilin B1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1541s21c1
Sequence:GTACCGGCAGAATCTATGTTAGCGATTTCTCGAGAAATCGCTAACATAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019464.2-538s21c1
Sequence:CCGGCGTATAAACAACCCGGAACTTCTCGAGAAGTTCCGGGTTGTTTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1346s21c1
Sequence:CCGGCCTACTTAGAACTTCTCAATTCTCGAGAATTGAGAAGTTCTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-983s21c1
Sequence:CCGGATGCACAGTGTTACCAGTATACTCGAGTATACTGGTAACACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1390s21c1
Sequence:CCGGACCCATCACAACACCATATTTCTCGAGAAATATGGTGTTGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1418s21c1
Sequence:CCGGTAACTCTAAAGCAGGTTTAAACTCGAGTTTAAACCTGCTTTAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019464.1-2559s1c1
Sequence:CCGGGCGGAGTACAAAGGTGTAGTTCTCGAGAACTACACCTTTGTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-1346s1c1
Sequence:CCGGCCTACTTAGAACTTCTCAATTCTCGAGAATTGAGAAGTTCTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-538s1c1
Sequence:CCGGCGTATAAACAACCCGGAACTTCTCGAGAAGTTCCGGGTTGTTTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-605s1c1
Sequence:CCGGCAGCTTATGGAAATGCCCTTACTCGAGTAAGGGCATTTCCATAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-607s1c1
Sequence:CCGGGCTTATGGAAATGCCCTTATTCTCGAGAATAAGGGCATTTCCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019464
VALIDATED
SH3GLB1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like endophilin B1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1541s21c1
Sequence:GTACCGGCAGAATCTATGTTAGCGATTTCTCGAGAAATCGCTAACATAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019464.2-538s21c1
Sequence:CCGGCGTATAAACAACCCGGAACTTCTCGAGAAGTTCCGGGTTGTTTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1346s21c1
Sequence:CCGGCCTACTTAGAACTTCTCAATTCTCGAGAATTGAGAAGTTCTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-983s21c1
Sequence:CCGGATGCACAGTGTTACCAGTATACTCGAGTATACTGGTAACACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1390s21c1
Sequence:CCGGACCCATCACAACACCATATTTCTCGAGAAATATGGTGTTGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019464.2-1418s21c1
Sequence:CCGGTAACTCTAAAGCAGGTTTAAACTCGAGTTTAAACCTGCTTTAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019464.1-2559s1c1
Sequence:CCGGGCGGAGTACAAAGGTGTAGTTCTCGAGAACTACACCTTTGTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-1346s1c1
Sequence:CCGGCCTACTTAGAACTTCTCAATTCTCGAGAATTGAGAAGTTCTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-538s1c1
Sequence:CCGGCGTATAAACAACCCGGAACTTCTCGAGAAGTTCCGGGTTGTTTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-605s1c1
Sequence:CCGGCAGCTTATGGAAATGCCCTTACTCGAGTAAGGGCATTTCCATAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019464.1-607s1c1
Sequence:CCGGGCTTATGGAAATGCCCTTATTCTCGAGAATAAGGGCATTTCCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016009
VALIDATED
SH3GLB1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like endophilin B1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-665s21c1
Sequence:CCGGTTATGGTAATGCCCTTATTAACTCGAGTTAATAAGGGCATTACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-1039s21c1
Sequence:CCGGATGCACAGTGTTACCAGTATACTCGAGTATACTGGTAACACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016009.3-2592s21c1
Sequence:CCGGCAGAGCTTAAAGACCATTAAACTCGAGTTTAATGGTCTTTAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-1181s21c1
Sequence:CCGGTTCAACAAGTGGCCTAGTAATCTCGAGATTACTAGGCCACTTGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-199s1c1
Sequence:CCGGGCTCACTTAGAGAACCTCCTTCTCGAGAAGGAGGTTCTCTAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-271s1c1
Sequence:CCGGGAAGTGTTATTGCAGCCAAATCTCGAGATTTGGCTGCAATAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-825s1c1
Sequence:CCGGCCAGAAACAACTGGGAAGTTTCTCGAGAAACTTCCCAGTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016009
VALIDATED
SH3GLB1 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like endophilin B1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-665s21c1
Sequence:CCGGTTATGGTAATGCCCTTATTAACTCGAGTTAATAAGGGCATTACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-1039s21c1
Sequence:CCGGATGCACAGTGTTACCAGTATACTCGAGTATACTGGTAACACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016009.3-2592s21c1
Sequence:CCGGCAGAGCTTAAAGACCATTAAACTCGAGTTTAATGGTCTTTAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-1181s21c1
Sequence:CCGGTTCAACAAGTGGCCTAGTAATCTCGAGATTACTAGGCCACTTGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-199s1c1
Sequence:CCGGGCTCACTTAGAGAACCTCCTTCTCGAGAAGGAGGTTCTCTAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-271s1c1
Sequence:CCGGGAAGTGTTATTGCAGCCAAATCTCGAGATTTGGCTGCAATAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-825s1c1
Sequence:CCGGCCAGAAACAACTGGGAAGTTTCTCGAGAAACTTCCCAGTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016009
VALIDATED
SH3GLB1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like endophilin B1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-665s21c1
Sequence:CCGGTTATGGTAATGCCCTTATTAACTCGAGTTAATAAGGGCATTACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-1039s21c1
Sequence:CCGGATGCACAGTGTTACCAGTATACTCGAGTATACTGGTAACACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016009.3-2592s21c1
Sequence:CCGGCAGAGCTTAAAGACCATTAAACTCGAGTTTAATGGTCTTTAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016009.3-1181s21c1
Sequence:CCGGTTCAACAAGTGGCCTAGTAATCTCGAGATTACTAGGCCACTTGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-199s1c1
Sequence:CCGGGCTCACTTAGAGAACCTCCTTCTCGAGAAGGAGGTTCTCTAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-271s1c1
Sequence:CCGGGAAGTGTTATTGCAGCCAAATCTCGAGATTTGGCTGCAATAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016009.2-825s1c1
Sequence:CCGGCCAGAAACAACTGGGAAGTTTCTCGAGAAACTTCCCAGTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks